EMAIL THIS PAGE TO A FRIEND

APOBEC3C

apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3C

61 Gene Product Result for
Synonyms: A3C APOBEC1L ARDC2 ARDC4 ARP5 PBI bK150C2.3
Species: Human APOBEC3C(27350), domestic cat APOBEC3C(100144583)
UniProtKB ID: Q9NRW3, B2R884, Q5JZ92, Q7Z2N7, Q96F12
Gene ID:
Human(27350) Summary: This gene is a member of the cytidine deaminase gene family. It is one of seven related genes or pseudogenes found in a cluster thought to result from gene duplication, on chromosome 22. Members of the cluster encode proteins that are structurally and functionally related to the C to U RNA-editing cytidine deaminase APOBEC1. It is thought that the proteins may be RNA editing enzymes and have roles in growth or cell cycle control. [provided by RefSeq, Jul 2008]
domestic cat(100144583) apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3C
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014508 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014508 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014508 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU223361 MISSION® esiRNA esiRNA targeting human APOBEC3C human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014508 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014508 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00153295 predicted 751
2 SASI_Hs01_00153296 predicted 466
3 SASI_Hs01_00153300 predicted 463
4 SASI_Hs01_00153301 predicted 204
5 SASI_Hs01_00153303 predicted 207
6 SASI_Hs02_00345775 predicted 188
7 SASI_Hs02_00345776 predicted 820
8 SASI_Hs01_00153297 predicted 635
9 SASI_Hs01_00153298 predicted 281
10 SASI_Hs01_00153299 predicted 439
11 SASI_Hs01_00153302 predicted 414
12 SASI_Hs01_00153304 predicted 610
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014508
VALIDATED
APOBEC3C MISSION shRNA Bacterial Glycerol Stock
apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3C
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000052098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014508.2-143s1c1
Sequence:CCGGCCAGGCACATTCTACTTCCAACTCGAGTTGGAAGTAGAATGTGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014508.2-629s1c1
Sequence:CCGGACCAACTTTCGACTTCTGAAACTCGAGTTTCAGAAGTCGAAAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014508.2-467s1c1
Sequence:CCGGCGCCTCTACTACTTCCAGTATCTCGAGATACTGGAAGTAGTAGAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014508.2-532s1c1
Sequence:CCGGCGCTGTGGAGATCATGGACTACTCGAGTAGTCCATGATCTCCACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014508.2-147s1c1
Sequence:CCGGGCACATTCTACTTCCAATTTACTCGAGTAAATTGGAAGTAGAATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014508.2-467s21c1
Sequence:CCGGCGCCTCTACTACTTCCAGTATCTCGAGATACTGGAAGTAGTAGAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_014508.2-532s21c1
Sequence:CCGGCGCTGTGGAGATCATGGACTACTCGAGTAGTCCATGATCTCCACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014508.2-147s21c1
Sequence:CCGGGCACATTCTACTTCCAATTTACTCGAGTAAATTGGAAGTAGAATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014508.2-629s21c1
Sequence:CCGGACCAACTTTCGACTTCTGAAACTCGAGTTTCAGAAGTCGAAAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014508
VALIDATED
APOBEC3C MISSION shRNA shRNA Plasmid DNA
apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3C
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000052098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014508.2-143s1c1
Sequence:CCGGCCAGGCACATTCTACTTCCAACTCGAGTTGGAAGTAGAATGTGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014508.2-629s1c1
Sequence:CCGGACCAACTTTCGACTTCTGAAACTCGAGTTTCAGAAGTCGAAAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014508.2-467s1c1
Sequence:CCGGCGCCTCTACTACTTCCAGTATCTCGAGATACTGGAAGTAGTAGAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014508.2-532s1c1
Sequence:CCGGCGCTGTGGAGATCATGGACTACTCGAGTAGTCCATGATCTCCACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014508.2-147s1c1
Sequence:CCGGGCACATTCTACTTCCAATTTACTCGAGTAAATTGGAAGTAGAATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014508.2-467s21c1
Sequence:CCGGCGCCTCTACTACTTCCAGTATCTCGAGATACTGGAAGTAGTAGAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_014508.2-532s21c1
Sequence:CCGGCGCTGTGGAGATCATGGACTACTCGAGTAGTCCATGATCTCCACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014508.2-147s21c1
Sequence:CCGGGCACATTCTACTTCCAATTTACTCGAGTAAATTGGAAGTAGAATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014508.2-629s21c1
Sequence:CCGGACCAACTTTCGACTTCTGAAACTCGAGTTTCAGAAGTCGAAAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014508
VALIDATED
APOBEC3C MISSION shRNA Lentiviral Transduction Particles
apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3C
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000052098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014508.2-143s1c1
Sequence:CCGGCCAGGCACATTCTACTTCCAACTCGAGTTGGAAGTAGAATGTGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014508.2-629s1c1
Sequence:CCGGACCAACTTTCGACTTCTGAAACTCGAGTTTCAGAAGTCGAAAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014508.2-467s1c1
Sequence:CCGGCGCCTCTACTACTTCCAGTATCTCGAGATACTGGAAGTAGTAGAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014508.2-532s1c1
Sequence:CCGGCGCTGTGGAGATCATGGACTACTCGAGTAGTCCATGATCTCCACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014508.2-147s1c1
Sequence:CCGGGCACATTCTACTTCCAATTTACTCGAGTAAATTGGAAGTAGAATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014508.2-467s21c1
Sequence:CCGGCGCCTCTACTACTTCCAGTATCTCGAGATACTGGAAGTAGTAGAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_014508.2-532s21c1
Sequence:CCGGCGCTGTGGAGATCATGGACTACTCGAGTAGTCCATGATCTCCACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014508.2-147s21c1
Sequence:CCGGGCACATTCTACTTCCAATTTACTCGAGTAAATTGGAAGTAGAATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014508.2-629s21c1
Sequence:CCGGACCAACTTTCGACTTCTGAAACTCGAGTTTCAGAAGTCGAAAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks