EMAIL THIS PAGE TO A FRIEND

APOBEC3D

apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3D

38 Gene Product Result for
Synonyms: A3D APOBEC3DE APOBEC3E ARP6
Species: Human APOBEC3D(140564)
UniProtKB ID: Q96AK3, Q5JZ91, Q7Z2N2, Q7Z2N5, Q7Z2N6
Gene ID:
Human(140564) Summary: This gene is a member of the cytidine deaminase gene family. It is one of a group of related genes found in a cluster, thought to result from gene duplication, on chromosome 22. Members of the cluster encode proteins that are structurally and functionally related to the C to U RNA-editing cytidine deaminase APOBEC1 and inhibit retroviruses, such as HIV, by deaminating cytosine residues in nascent retroviral cDNA. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152426 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152426 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152426 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU042291 MISSION® esiRNA esiRNA human RP11-429E11.3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152426 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152426 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00240928 predicted 625
2 SASI_Hs01_00240929 predicted 614
3 SASI_Hs01_00240932 predicted 803
4 SASI_Hs01_00240933 predicted 598
5 SASI_Hs01_00240935 predicted 626
6 SASI_Hs02_00366163 predicted 687
7 SASI_Hs02_00366164 predicted 809
8 SASI_Hs02_00366165 predicted 802
9 SASI_Hs01_00240926 predicted 630
10 SASI_Hs01_00240927 predicted 431
11 SASI_Hs01_00240930 predicted 470
12 SASI_Hs01_00240931 predicted 828
13 SASI_Hs01_00240934 predicted 389
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152426
APOBEC3D MISSION shRNA Bacterial Glycerol Stock
apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3D
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152426.3-1129s21c1
Sequence:CCGGACTCAGCTGTCTTCCGGAAGACTCGAGTCTTCCGGAAGACAGCTGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152426.3-746s21c1
Sequence:CCGGGGTGAAGGTGACCAAATTCTTCTCGAGAAGAATTTGGTCACCTTCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152426.3-1480s21c1
Sequence:CCGGACAGTGATGATGAGCCATTCACTCGAGTGAATGGCTCATCATCACTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152426.3-1104s21c1
Sequence:CCGGTTCACCATGGAAGTTACAAAGCTCGAGCTTTGTAACTTCCATGGTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152426.3-1363s21c1
Sequence:CCGGTCTGCTACTTCTGGGATACAGCTCGAGCTGTATCCCAGAAGTAGCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157748    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152426.1-494s1c1
Sequence:CCGGCCGTGTGAAGATCATGGACTACTCGAGTAGTCCATGATCTTCACACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152426.1-211s1c1
Sequence:CCGGCCAAACGTCAGTCGAATCACACTCGAGTGTGATTCGACTGACGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152426.1-163s1c1
Sequence:CCGGGCTCAAATCTCCTTTGGGACACTCGAGTGTCCCAAAGGAGATTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152426.1-59s1c1
Sequence:CCGGGCGGATGTATCGAGACACATTCTCGAGAATGTGTCTCGATACATCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155812    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152426.1-495s1c1
Sequence:CCGGCGTGTGAAGATCATGGACTATCTCGAGATAGTCCATGATCTTCACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152426.1-251s1c1
Sequence:CCGGGTTTGAGAACCACGCAGAAATCTCGAGATTTCTGCGTGGTTCTCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152426.1-503s1c1
Sequence:CCGGGATCATGGACTATGAAGGTGACTCGAGTCACCTTCATAGTCCATGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152426
APOBEC3D MISSION shRNA shRNA Plasmid DNA
apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3D
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152426.3-1129s21c1
Sequence:CCGGACTCAGCTGTCTTCCGGAAGACTCGAGTCTTCCGGAAGACAGCTGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152426.3-746s21c1
Sequence:CCGGGGTGAAGGTGACCAAATTCTTCTCGAGAAGAATTTGGTCACCTTCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152426.3-1480s21c1
Sequence:CCGGACAGTGATGATGAGCCATTCACTCGAGTGAATGGCTCATCATCACTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152426.3-1104s21c1
Sequence:CCGGTTCACCATGGAAGTTACAAAGCTCGAGCTTTGTAACTTCCATGGTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152426.3-1363s21c1
Sequence:CCGGTCTGCTACTTCTGGGATACAGCTCGAGCTGTATCCCAGAAGTAGCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157748    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152426.1-494s1c1
Sequence:CCGGCCGTGTGAAGATCATGGACTACTCGAGTAGTCCATGATCTTCACACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152426.1-211s1c1
Sequence:CCGGCCAAACGTCAGTCGAATCACACTCGAGTGTGATTCGACTGACGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152426.1-163s1c1
Sequence:CCGGGCTCAAATCTCCTTTGGGACACTCGAGTGTCCCAAAGGAGATTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152426.1-59s1c1
Sequence:CCGGGCGGATGTATCGAGACACATTCTCGAGAATGTGTCTCGATACATCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155812    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152426.1-495s1c1
Sequence:CCGGCGTGTGAAGATCATGGACTATCTCGAGATAGTCCATGATCTTCACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152426.1-251s1c1
Sequence:CCGGGTTTGAGAACCACGCAGAAATCTCGAGATTTCTGCGTGGTTCTCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152426.1-503s1c1
Sequence:CCGGGATCATGGACTATGAAGGTGACTCGAGTCACCTTCATAGTCCATGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152426
APOBEC3D MISSION shRNA Lentiviral Transduction Particles
apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3D
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152426.3-1129s21c1
Sequence:CCGGACTCAGCTGTCTTCCGGAAGACTCGAGTCTTCCGGAAGACAGCTGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152426.3-746s21c1
Sequence:CCGGGGTGAAGGTGACCAAATTCTTCTCGAGAAGAATTTGGTCACCTTCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152426.3-1480s21c1
Sequence:CCGGACAGTGATGATGAGCCATTCACTCGAGTGAATGGCTCATCATCACTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152426.3-1104s21c1
Sequence:CCGGTTCACCATGGAAGTTACAAAGCTCGAGCTTTGTAACTTCCATGGTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152426.3-1363s21c1
Sequence:CCGGTCTGCTACTTCTGGGATACAGCTCGAGCTGTATCCCAGAAGTAGCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157748    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152426.1-494s1c1
Sequence:CCGGCCGTGTGAAGATCATGGACTACTCGAGTAGTCCATGATCTTCACACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152426.1-211s1c1
Sequence:CCGGCCAAACGTCAGTCGAATCACACTCGAGTGTGATTCGACTGACGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152426.1-163s1c1
Sequence:CCGGGCTCAAATCTCCTTTGGGACACTCGAGTGTCCCAAAGGAGATTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152426.1-59s1c1
Sequence:CCGGGCGGATGTATCGAGACACATTCTCGAGAATGTGTCTCGATACATCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155812    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152426.1-495s1c1
Sequence:CCGGCGTGTGAAGATCATGGACTATCTCGAGATAGTCCATGATCTTCACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152426.1-251s1c1
Sequence:CCGGGTTTGAGAACCACGCAGAAATCTCGAGATTTCTGCGTGGTTCTCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152426.1-503s1c1
Sequence:CCGGGATCATGGACTATGAAGGTGACTCGAGTCACCTTCATAGTCCATGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks