EMAIL THIS PAGE TO A FRIEND

APOBEC3F

apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3F

235 Gene Product Result for
Synonyms: A3F ARP8 BK150C2.4.MRNA KA6
UniProtKB ID: Q8IUX4, B0QYD4, Q45F03, Q6ICH3, Q7Z2N2, Q7Z2N5
Gene ID:
Human(200316) Summary: This gene is a member of the cytidine deaminase gene family. It is one of seven related genes or pseudogenes found in a cluster, thought to result from gene duplication, on chromosome 22. Members of the cluster encode proteins that are structurally and functionally related to the C to U RNA-editing cytidine deaminase APOBEC1. It is thought that the proteins may be RNA editing enzymes and have roles in growth or cell cycle control. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Horse(100070221) apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3F
sheep(100037691) apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3F
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145298 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145298 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145298 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU095321 MISSION® esiRNA esiRNA human APOBEC3F (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001006666 Rosetta Predictions human pricing
NM_145298 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001006666 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00227580 predicted 570
2 SASI_Hs01_00227581 predicted 713
3 SASI_Hs02_00305129 predicted 430
4 SASI_Hs01_00227582 predicted 307
5 SASI_Hs01_00227583 predicted 697
6 SASI_Hs01_00227584 predicted 715
7 SASI_Hs01_00227585 predicted 746
8 SASI_Hs01_00227586 predicted 328
9 SASI_Hs01_00227587 predicted 586
10 SASI_Hs02_00305130 predicted 374
11 SASI_Hs01_00227579 predicted 655
12 SASI_Hs01_00227588 predicted 372
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145298 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00365189 predicted 722
2 SASI_Hs02_00365190 predicted 331
3 SASI_Hs01_00022852 predicted 335
4 SASI_Hs02_00365191 predicted 432
5 SASI_Hs02_00365192 predicted 379
6 SASI_Hs02_00365193 predicted 716
7 SASI_Hs01_00022844 predicted 870
8 SASI_Hs01_00022845 predicted 1208
9 SASI_Hs01_00022846 predicted 1007
10 SASI_Hs01_00022847 predicted 1187
11 SASI_Hs01_00022848 predicted 888
12 SASI_Hs01_00022849 predicted 1075
13 SASI_Hs01_00022850 predicted 850
14 SASI_Hs01_00022851 predicted 1323
15 SASI_Hs01_00022853 predicted 933
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145298
APOBEC3F MISSION shRNA Bacterial Glycerol Stock
apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3F
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000052124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145298.3-1275s1c1
Sequence:CCGGGTGGAGATCATGGGCTACAAACTCGAGTTTGTAGCCCATGATCTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145298.3-949s1c1
Sequence:CCGGGCTTCACCATGGAAGTTGTAACTCGAGTTACAACTTCCATGGTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145298.3-367s1c1
Sequence:CCGGCCATCCTTTCTCGTCGGAATACTCGAGTATTCCGACGAGAAAGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145298.3-871s1c1
Sequence:CCGGAGGCAATGTATCCACACATATCTCGAGATATGTGTGGATACATTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145298.3-720s1c1
Sequence:CCGGCGCGTGAAGATTATGGACGATCTCGAGATCGTCCATAATCTTCACGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000447203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145298.5-1389s21c1
Sequence:CCGGAGCAAGCTGCAGGAGATTCTCCTCGAGGAGAATCTCCTGCAGCTTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145298.5-735s21c1
Sequence:CCGGGACGATGAAGAATTTGCATACCTCGAGGTATGCAAATTCTTCATCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000442334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145298.5-922s21c1
Sequence:CCGGCCTATGGTCGGAACGAAAGCTCTCGAGAGCTTTCGTTCCGACCATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145298
APOBEC3F MISSION shRNA shRNA Plasmid DNA
apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3F
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000052124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145298.3-1275s1c1
Sequence:CCGGGTGGAGATCATGGGCTACAAACTCGAGTTTGTAGCCCATGATCTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145298.3-949s1c1
Sequence:CCGGGCTTCACCATGGAAGTTGTAACTCGAGTTACAACTTCCATGGTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145298.3-367s1c1
Sequence:CCGGCCATCCTTTCTCGTCGGAATACTCGAGTATTCCGACGAGAAAGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145298.3-871s1c1
Sequence:CCGGAGGCAATGTATCCACACATATCTCGAGATATGTGTGGATACATTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145298.3-720s1c1
Sequence:CCGGCGCGTGAAGATTATGGACGATCTCGAGATCGTCCATAATCTTCACGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000447203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145298.5-1389s21c1
Sequence:CCGGAGCAAGCTGCAGGAGATTCTCCTCGAGGAGAATCTCCTGCAGCTTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145298.5-735s21c1
Sequence:CCGGGACGATGAAGAATTTGCATACCTCGAGGTATGCAAATTCTTCATCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000442334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145298.5-922s21c1
Sequence:CCGGCCTATGGTCGGAACGAAAGCTCTCGAGAGCTTTCGTTCCGACCATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145298
APOBEC3F MISSION shRNA Lentiviral Transduction Particles
apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3F
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000052124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145298.3-1275s1c1
Sequence:CCGGGTGGAGATCATGGGCTACAAACTCGAGTTTGTAGCCCATGATCTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145298.3-949s1c1
Sequence:CCGGGCTTCACCATGGAAGTTGTAACTCGAGTTACAACTTCCATGGTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145298.3-367s1c1
Sequence:CCGGCCATCCTTTCTCGTCGGAATACTCGAGTATTCCGACGAGAAAGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145298.3-871s1c1
Sequence:CCGGAGGCAATGTATCCACACATATCTCGAGATATGTGTGGATACATTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145298.3-720s1c1
Sequence:CCGGCGCGTGAAGATTATGGACGATCTCGAGATCGTCCATAATCTTCACGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000447203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145298.5-1389s21c1
Sequence:CCGGAGCAAGCTGCAGGAGATTCTCCTCGAGGAGAATCTCCTGCAGCTTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145298.5-735s21c1
Sequence:CCGGGACGATGAAGAATTTGCATACCTCGAGGTATGCAAATTCTTCATCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000442334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145298.5-922s21c1
Sequence:CCGGCCTATGGTCGGAACGAAAGCTCTCGAGAGCTTTCGTTCCGACCATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks