EMAIL THIS PAGE TO A FRIEND

APOBEC3G

apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3G

44 Gene Product Result for
Synonyms: A3G ARCD ARP-9 ARP9 CEM-15 CEM15 bK150C2.7 dJ494G10.1
Species: Human APOBEC3G(60489)
Gene ID:
Human(60489) Summary: This gene is a member of the cytidine deaminase gene family. It is one of seven related genes or pseudogenes found in a cluster, thought to result from gene duplication, on chromosome 22. Members of the cluster encode proteins that are structurally and functionally related to the C to U RNA-editing cytidine deaminase APOBEC1. It is thought that the proteins may be RNA editing enzymes and have roles in growth or cell cycle control. The protein encoded by this gene has been found to be a specific inhibitor of human immunodeficiency virus-1 (HIV-1) infectivity. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021822 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021822 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021822 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021822 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021822 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00174399 predicted 680
2 SASI_Hs01_00174400 predicted 1165
3 SASI_Hs01_00174401 predicted 519
4 SASI_Hs01_00174402 predicted 428
5 SASI_Hs01_00174403 predicted 737
6 SASI_Hs01_00174404 predicted 792
7 SASI_Hs01_00174405 predicted 708
8 SASI_Hs01_00174406 predicted 752
9 SASI_Hs01_00174407 predicted 752
10 SASI_Hs01_00174408 predicted 266
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021822
APOBEC3G MISSION shRNA Bacterial Glycerol Stock
apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3G
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000440501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021822.2-581s21c1
Sequence:CCGGTGCATCGTGACCAGGAGTATGCTCGAGCATACTCCTGGTCACGATGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418047    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021822.2-1658s21c1
Sequence:CCGGATTAGAGTGCATTACTTTGAACTCGAGTTCAAAGTAATGCACTCTAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425724    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021822.2-1717s21c1
Sequence:CCGGATTGTGCTCAATACACAGAAACTCGAGTTTCTGTGTATTGAGCACAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021822.1-970s1c1
Sequence:CCGGCCACATAAACACGGTTTCCTTCTCGAGAAGGAAACCGTGTTTATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021822.1-1165s1c1
Sequence:CCGGGCCCGCATCTATGATGATCAACTCGAGTTGATCATCATAGATGCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021822.1-876s1c1
Sequence:CCGGGCATGAGACTTACCTGTGTTACTCGAGTAACACAGGTAAGTCTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021822.1-398s1c1
Sequence:CCGGGCCAGGTGTATTCCGAACTTACTCGAGTAAGTTCGGAATACACCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021822.1-751s1c1
Sequence:CCGGCCTTGGAATAATCTGCCTAAACTCGAGTTTAGGCAGATTATTCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021822
APOBEC3G MISSION shRNA shRNA Plasmid DNA
apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3G
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000440501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021822.2-581s21c1
Sequence:CCGGTGCATCGTGACCAGGAGTATGCTCGAGCATACTCCTGGTCACGATGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418047    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021822.2-1658s21c1
Sequence:CCGGATTAGAGTGCATTACTTTGAACTCGAGTTCAAAGTAATGCACTCTAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425724    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021822.2-1717s21c1
Sequence:CCGGATTGTGCTCAATACACAGAAACTCGAGTTTCTGTGTATTGAGCACAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021822.1-970s1c1
Sequence:CCGGCCACATAAACACGGTTTCCTTCTCGAGAAGGAAACCGTGTTTATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021822.1-1165s1c1
Sequence:CCGGGCCCGCATCTATGATGATCAACTCGAGTTGATCATCATAGATGCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021822.1-876s1c1
Sequence:CCGGGCATGAGACTTACCTGTGTTACTCGAGTAACACAGGTAAGTCTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021822.1-398s1c1
Sequence:CCGGGCCAGGTGTATTCCGAACTTACTCGAGTAAGTTCGGAATACACCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021822.1-751s1c1
Sequence:CCGGCCTTGGAATAATCTGCCTAAACTCGAGTTTAGGCAGATTATTCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021822
APOBEC3G MISSION shRNA Lentiviral Transduction Particles
apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3G
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000440501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021822.2-581s21c1
Sequence:CCGGTGCATCGTGACCAGGAGTATGCTCGAGCATACTCCTGGTCACGATGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418047    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021822.2-1658s21c1
Sequence:CCGGATTAGAGTGCATTACTTTGAACTCGAGTTCAAAGTAATGCACTCTAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425724    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021822.2-1717s21c1
Sequence:CCGGATTGTGCTCAATACACAGAAACTCGAGTTTCTGTGTATTGAGCACAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021822.1-970s1c1
Sequence:CCGGCCACATAAACACGGTTTCCTTCTCGAGAAGGAAACCGTGTTTATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021822.1-1165s1c1
Sequence:CCGGGCCCGCATCTATGATGATCAACTCGAGTTGATCATCATAGATGCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021822.1-876s1c1
Sequence:CCGGGCATGAGACTTACCTGTGTTACTCGAGTAACACAGGTAAGTCTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021822.1-398s1c1
Sequence:CCGGGCCAGGTGTATTCCGAACTTACTCGAGTAAGTTCGGAATACACCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021822.1-751s1c1
Sequence:CCGGCCTTGGAATAATCTGCCTAAACTCGAGTTTAGGCAGATTATTCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks