EMAIL THIS PAGE TO A FRIEND

APOBEC3H

apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3H

40 Gene Product Result for
Synonyms: A3H ARP10
Gene ID:
Human(164668) Summary: This gene encodes a member of the apolipoprotein B mRNA-editing enzyme catalytic polypeptide 3 family of proteins. The encoded protein is a cytidine deaminase that has antiretroviral activity by generating lethal hypermutations in viral genomes. Polymorphisms and alternative splicing in this gene influence its antiretroviral activity and are associated with increased resistence to human immunodeficiency virus type 1 infection in certain populations. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Oct 2009]
domestic cat(100127022) apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3H
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_181773 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_181773 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_181773 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU067761 MISSION® esiRNA esiRNA human APOBEC3H (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_181773 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181773 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00043849 predicted 662
2 SASI_Hs01_00043850 predicted 280
3 SASI_Hs01_00043851 predicted 269
4 SASI_Hs01_00043853 predicted 577
5 SASI_Hs01_00043854 predicted 664
6 SASI_Hs02_00370363 predicted 663
7 SASI_Hs02_00370364 predicted 277
8 SASI_Hs01_00043855 predicted 465
9 SASI_Hs01_00043856 predicted 550
10 SASI_Hs01_00043857 predicted 506
11 SASI_Hs01_00043852 predicted 292
12 SASI_Hs01_00043858 predicted 246
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181773
APOBEC3H MISSION shRNA Bacterial Glycerol Stock
apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3H
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000051798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181773.2-224s1c1
Sequence:CCGGGCCATGCAGAAATTTGCTTTACTCGAGTAAAGCAAATTTCTGCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181773.2-93s1c1
Sequence:CCGGCCGCTTACAGTTTAACAACAACTCGAGTTGTTGTTAAACTGTAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181773.2-516s1c1
Sequence:CCGGCCACGAGAAACCGCTTTCCTTCTCGAGAAGGAAAGCGGTTTCTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181773.2-117s1c1
Sequence:CCGGCCGCCTCAGAAGGCCTTACTACTCGAGTAGTAAGGCCTTCTGAGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181773.2-577s1c1
Sequence:CCGGCGAGCCATAAAGCGACGGCTTCTCGAGAAGCCGTCGCTTTATGGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000445960    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181773.3-774s21c1
Sequence:CCGGGGCATGTCAGTTGCCTCATAGCTCGAGCTATGAGGCAACTGACATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181773.3-333s21c1
Sequence:CCGGACGAAACGCAGTGCTACCAAGCTCGAGCTTGGTAGCACTGCGTTTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434712    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181773.3-695s21c1
Sequence:CCGGGAGAATGACTTAAGAAGTTTGCTCGAGCAAACTTCTTAAGTCATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000445571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181773.3-428s21c1
Sequence:CCGGCATCTGAACCTGGGCATCTTCCTCGAGGAAGATGCCCAGGTTCAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181773
APOBEC3H MISSION shRNA shRNA Plasmid DNA
apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3H
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000051798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181773.2-224s1c1
Sequence:CCGGGCCATGCAGAAATTTGCTTTACTCGAGTAAAGCAAATTTCTGCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181773.2-93s1c1
Sequence:CCGGCCGCTTACAGTTTAACAACAACTCGAGTTGTTGTTAAACTGTAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181773.2-516s1c1
Sequence:CCGGCCACGAGAAACCGCTTTCCTTCTCGAGAAGGAAAGCGGTTTCTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181773.2-117s1c1
Sequence:CCGGCCGCCTCAGAAGGCCTTACTACTCGAGTAGTAAGGCCTTCTGAGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181773.2-577s1c1
Sequence:CCGGCGAGCCATAAAGCGACGGCTTCTCGAGAAGCCGTCGCTTTATGGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000445960    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181773.3-774s21c1
Sequence:CCGGGGCATGTCAGTTGCCTCATAGCTCGAGCTATGAGGCAACTGACATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181773.3-333s21c1
Sequence:CCGGACGAAACGCAGTGCTACCAAGCTCGAGCTTGGTAGCACTGCGTTTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434712    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181773.3-695s21c1
Sequence:CCGGGAGAATGACTTAAGAAGTTTGCTCGAGCAAACTTCTTAAGTCATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000445571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181773.3-428s21c1
Sequence:CCGGCATCTGAACCTGGGCATCTTCCTCGAGGAAGATGCCCAGGTTCAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181773
APOBEC3H MISSION shRNA Lentiviral Transduction Particles
apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3H
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000051798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181773.2-224s1c1
Sequence:CCGGGCCATGCAGAAATTTGCTTTACTCGAGTAAAGCAAATTTCTGCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181773.2-93s1c1
Sequence:CCGGCCGCTTACAGTTTAACAACAACTCGAGTTGTTGTTAAACTGTAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181773.2-516s1c1
Sequence:CCGGCCACGAGAAACCGCTTTCCTTCTCGAGAAGGAAAGCGGTTTCTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181773.2-117s1c1
Sequence:CCGGCCGCCTCAGAAGGCCTTACTACTCGAGTAGTAAGGCCTTCTGAGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181773.2-577s1c1
Sequence:CCGGCGAGCCATAAAGCGACGGCTTCTCGAGAAGCCGTCGCTTTATGGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000445960    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181773.3-774s21c1
Sequence:CCGGGGCATGTCAGTTGCCTCATAGCTCGAGCTATGAGGCAACTGACATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181773.3-333s21c1
Sequence:CCGGACGAAACGCAGTGCTACCAAGCTCGAGCTTGGTAGCACTGCGTTTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434712    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181773.3-695s21c1
Sequence:CCGGGAGAATGACTTAAGAAGTTTGCTCGAGCAAACTTCTTAAGTCATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000445571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181773.3-428s21c1
Sequence:CCGGCATCTGAACCTGGGCATCTTCCTCGAGGAAGATGCCCAGGTTCAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks