EMAIL THIS PAGE TO A FRIEND

APOBEC4

apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 4 (putative)

124 Gene Product Result for
Synonyms: C1orf169
UniProtKB ID: Q8WW27, Q8N7F6
Gene ID:
Human(403314) Summary: This gene encodes a member of the AID/APOBEC family of polynucleotide (deoxy)cytidine deaminases, which convert cytidine to uridine. Other AID/APOBEC family members are involved in mRNA editing, somatic hypermutation and recombination of immunoglobulin genes, and innate immunity to retroviral infection. [provided by RefSeq, Jul 2008]
Mouse(71281) apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 4 (putative)
Rat(498251) apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 4 (putative)
sheep(101121695) apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 4 (putative)
domestic guinea pig(100732868) apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 4 (putative)
naked mole-rat(101714349) apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 4 (putative)
chicken(100858926) apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 4 (putative)
cow(100300920) apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 4 (putative)
domestic cat(101087960) apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 4 (putative)
dog(610630) apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 4 (putative)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001081197 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081197 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081197 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_203454 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_203454 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_203454 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_203454 Rosetta Predictions human pricing
NM_001017492 Rosetta Predictions rat pricing
NM_001081197 Rosetta Predictions mouse pricing
XM_355245 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203454 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00164694 predicted 562
2 SASI_Hs02_00373384 predicted 575
3 SASI_Hs01_00164695 predicted 1408
4 SASI_Hs02_00373385 predicted 1241
5 SASI_Hs01_00164696 predicted 1473
6 SASI_Hs01_00164698 predicted 1160
7 SASI_Hs01_00164699 predicted 944
8 SASI_Hs01_00164700 predicted 1194
9 SASI_Hs01_00164702 predicted 582
10 SASI_Hs01_00164703 predicted 559
11 SASI_Hs01_00164697 predicted 550
12 SASI_Hs01_00164701 predicted 1173
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017492 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00097300 predicted 222
2 SASI_Rn01_00097301 predicted 245
3 SASI_Rn01_00097302 predicted 766
4 SASI_Rn01_00097303 predicted 857
5 SASI_Rn01_00097305 predicted 539
6 SASI_Rn01_00097306 predicted 275
7 SASI_Rn01_00097307 predicted 321
8 SASI_Rn02_00202309 predicted 868
9 SASI_Rn01_00097308 predicted 355
10 SASI_Rn01_00097309 predicted 661
11 SASI_Rn01_00097304 predicted 746
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081197 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00296141 predicted 279
2 SASI_Mm02_00296142 predicted 781
3 SASI_Mm02_00296143 predicted 404
4 SASI_Mm02_00296144 predicted 887
5 SASI_Mm02_00296145 predicted 1181
6 SASI_Mm02_00296146 predicted 377
7 SASI_Mm02_00296147 predicted 914
8 SASI_Mm02_00296148 predicted 674
9 SASI_Mm02_00296149 predicted 841
10 SASI_Mm02_00296150 predicted 1157
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_355245 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00282226 predicted 283
2 SASI_Mm01_00282227 predicted 295
3 SASI_Mm01_00282228 predicted 311
4 SASI_Mm01_00282229 predicted 277
5 SASI_Mm01_00282230 predicted 269
6 SASI_Mm01_00282231 predicted 264
7 SASI_Mm01_00282232 predicted 314
8 SASI_Mm01_00282233 predicted 278
9 SASI_Mm01_00282234 predicted 299
10 SASI_Mm01_00282235 predicted 274
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081197
APOBEC4 MISSION shRNA Bacterial Glycerol Stock
apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 4 (putative)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081197.1-812s21c1
Sequence:CCGGGGTGGCCTTTGGCATGCTATTCTCGAGAATAGCATGCCAAAGGCCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081197.1-1338s21c1
Sequence:CCGGAGCCAAGAATTTGCCGTTTACCTCGAGGTAAACGGCAAATTCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081197.1-330s21c1
Sequence:CCGGCCAACTGCCCTTACCACATTCCTCGAGGAATGTGGTAAGGGCAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081197.1-896s21c1
Sequence:CCGGATCCTGGCTGACAGGTATAACCTCGAGGTTATACCTGTCAGCCAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253953    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081197.1-1396s21c1
Sequence:CCGGATTCTCTCTCCCAGGTCTGACCTCGAGGTCAGACCTGGGAGAGAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081197
APOBEC4 MISSION shRNA shRNA Plasmid DNA
apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 4 (putative)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081197.1-812s21c1
Sequence:CCGGGGTGGCCTTTGGCATGCTATTCTCGAGAATAGCATGCCAAAGGCCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081197.1-1338s21c1
Sequence:CCGGAGCCAAGAATTTGCCGTTTACCTCGAGGTAAACGGCAAATTCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081197.1-330s21c1
Sequence:CCGGCCAACTGCCCTTACCACATTCCTCGAGGAATGTGGTAAGGGCAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081197.1-896s21c1
Sequence:CCGGATCCTGGCTGACAGGTATAACCTCGAGGTTATACCTGTCAGCCAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253953    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081197.1-1396s21c1
Sequence:CCGGATTCTCTCTCCCAGGTCTGACCTCGAGGTCAGACCTGGGAGAGAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081197
APOBEC4 MISSION shRNA Lentiviral Transduction Particles
apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 4 (putative)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081197.1-812s21c1
Sequence:CCGGGGTGGCCTTTGGCATGCTATTCTCGAGAATAGCATGCCAAAGGCCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081197.1-1338s21c1
Sequence:CCGGAGCCAAGAATTTGCCGTTTACCTCGAGGTAAACGGCAAATTCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081197.1-330s21c1
Sequence:CCGGCCAACTGCCCTTACCACATTCCTCGAGGAATGTGGTAAGGGCAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081197.1-896s21c1
Sequence:CCGGATCCTGGCTGACAGGTATAACCTCGAGGTTATACCTGTCAGCCAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253953    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081197.1-1396s21c1
Sequence:CCGGATTCTCTCTCCCAGGTCTGACCTCGAGGTCAGACCTGGGAGAGAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_203454
APOBEC4 MISSION shRNA Bacterial Glycerol Stock
apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 4 (putative)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000128993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203454.1-526s1c1
Sequence:CCGGGCAGTTGCACTGGGAATTATACTCGAGTATAATTCCCAGTGCAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203454.1-947s1c1
Sequence:CCGGCGCATATGAAATCAATGCCATCTCGAGATGGCATTGATTTCATATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203454.1-382s1c1
Sequence:CCGGCAGGTGAAGAAGCAAGAGTTTCTCGAGAAACTCTTGCTTCTTCACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149904    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_203454.1-1770s1c1
Sequence:CCGGGCCTGAAGCTACTGACATTAACTCGAGTTAATGTCAGTAGCTTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146859    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203454.1-743s1c1
Sequence:CCGGCTATCATACTGAGATGGACTTCTCGAGAAGTCCATCTCAGTATGATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146430    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203454.1-548s1c1
Sequence:CCGGCCATCCAGAATCAATGCTCTTCTCGAGAAGAGCATTGATTCTGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203454.1-981s1c1
Sequence:CCGGCCTTACTTCACTGATGTTCTTCTCGAGAAGAACATCAGTGAAGTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147093    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_203454.1-2253s1c1
Sequence:CCGGCCAATGATTGTAACTCAGCATCTCGAGATGCTGAGTTACAATCATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149043    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203454.1-430s1c1
Sequence:CCGGGATTCCCTTATGGGACAACATCTCGAGATGTTGTCCCATAAGGGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203454.1-708s1c1
Sequence:CCGGCCAGGCATCACTCTTAGTATTCTCGAGAATACTAAGAGTGATGCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_203454
APOBEC4 MISSION shRNA shRNA Plasmid DNA
apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 4 (putative)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000128993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203454.1-526s1c1
Sequence:CCGGGCAGTTGCACTGGGAATTATACTCGAGTATAATTCCCAGTGCAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203454.1-947s1c1
Sequence:CCGGCGCATATGAAATCAATGCCATCTCGAGATGGCATTGATTTCATATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203454.1-382s1c1
Sequence:CCGGCAGGTGAAGAAGCAAGAGTTTCTCGAGAAACTCTTGCTTCTTCACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149904    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_203454.1-1770s1c1
Sequence:CCGGGCCTGAAGCTACTGACATTAACTCGAGTTAATGTCAGTAGCTTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146859    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203454.1-743s1c1
Sequence:CCGGCTATCATACTGAGATGGACTTCTCGAGAAGTCCATCTCAGTATGATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146430    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203454.1-548s1c1
Sequence:CCGGCCATCCAGAATCAATGCTCTTCTCGAGAAGAGCATTGATTCTGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203454.1-981s1c1
Sequence:CCGGCCTTACTTCACTGATGTTCTTCTCGAGAAGAACATCAGTGAAGTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147093    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_203454.1-2253s1c1
Sequence:CCGGCCAATGATTGTAACTCAGCATCTCGAGATGCTGAGTTACAATCATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149043    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203454.1-430s1c1
Sequence:CCGGGATTCCCTTATGGGACAACATCTCGAGATGTTGTCCCATAAGGGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203454.1-708s1c1
Sequence:CCGGCCAGGCATCACTCTTAGTATTCTCGAGAATACTAAGAGTGATGCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_203454
APOBEC4 MISSION shRNA Lentiviral Transduction Particles
apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 4 (putative)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000128993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203454.1-526s1c1
Sequence:CCGGGCAGTTGCACTGGGAATTATACTCGAGTATAATTCCCAGTGCAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203454.1-947s1c1
Sequence:CCGGCGCATATGAAATCAATGCCATCTCGAGATGGCATTGATTTCATATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203454.1-382s1c1
Sequence:CCGGCAGGTGAAGAAGCAAGAGTTTCTCGAGAAACTCTTGCTTCTTCACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149904    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_203454.1-1770s1c1
Sequence:CCGGGCCTGAAGCTACTGACATTAACTCGAGTTAATGTCAGTAGCTTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146859    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203454.1-743s1c1
Sequence:CCGGCTATCATACTGAGATGGACTTCTCGAGAAGTCCATCTCAGTATGATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146430    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203454.1-548s1c1
Sequence:CCGGCCATCCAGAATCAATGCTCTTCTCGAGAAGAGCATTGATTCTGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203454.1-981s1c1
Sequence:CCGGCCTTACTTCACTGATGTTCTTCTCGAGAAGAACATCAGTGAAGTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147093    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_203454.1-2253s1c1
Sequence:CCGGCCAATGATTGTAACTCAGCATCTCGAGATGCTGAGTTACAATCATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149043    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203454.1-430s1c1
Sequence:CCGGGATTCCCTTATGGGACAACATCTCGAGATGTTGTCCCATAAGGGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203454.1-708s1c1
Sequence:CCGGCCAGGCATCACTCTTAGTATTCTCGAGAATACTAAGAGTGATGCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks