EMAIL THIS PAGE TO A FRIEND

APOBR

apolipoprotein B receptor

91 Gene Product Result for
Synonyms: APOB100R APOB48R
UniProtKB ID: Q0VD83, H3BU97, Q0VD81, Q8NC15, Q9NPJ9
Gene ID:
Human(55911) Summary: Apolipoprotein B48 receptor is a macrophage receptor that binds to the apolipoprotein B48 of dietary triglyceride (TG)-rich lipoproteins. This receptor may provide essential lipids, lipid-soluble vitamins and other nutrients to reticuloendothelial cells. If overwhelmed with elevated plasma triglyceride, the apolipoprotein B48 receptor may contribute to foam cell formation, endothelial dysfunction, and atherothrombogenesis. [provided by RefSeq, Jul 2008]
Mouse(171504) apolipoprotein B receptor
Rat(499264) apolipoprotein B receptor
domestic cat(101094069) apolipoprotein B receptor
cow(504800) apolipoprotein B receptor
naked mole-rat(101724473) apolipoprotein B receptor
domestic guinea pig(101788214) apolipoprotein B receptor
sheep(101122247) apolipoprotein B receptor
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138310 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_138310 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_138310 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_182804 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182804 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182804 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU000751 MISSION® esiRNA esiRNA targeting human APOB48R (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018690 Rosetta Predictions human pricing
NM_182804 Rosetta Predictions human pricing
NM_001109154 Rosetta Predictions rat pricing
NM_138310 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018690 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00352209 predicted 1130
2 SASI_Hs02_00352210 predicted 1378
3 SASI_Hs01_00147734 predicted 1747
4 SASI_Hs02_00352211 predicted 1129
5 SASI_Hs01_00147737 predicted 1926
6 SASI_Hs01_00147740 predicted 1579
7 SASI_Hs01_00147741 predicted 2628
8 SASI_Hs02_00352212 predicted 2170
9 SASI_Hs02_00352213 predicted 256
10 SASI_Hs02_00352214 predicted 1874
11 SASI_Hs01_00147732 predicted 1132
12 SASI_Hs01_00147733 predicted 1142
13 SASI_Hs01_00147735 predicted 1144
14 SASI_Hs01_00147736 predicted 1174
15 SASI_Hs01_00147738 predicted 777
16 SASI_Hs01_00147739 predicted 1142
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182804 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00133364 predicted 1135
2 SASI_Hs01_00133365 predicted 1136
3 SASI_Hs01_00133366 predicted 1750
4 SASI_Hs01_00133367 predicted 1144
5 SASI_Hs01_00133368 predicted 1167
6 SASI_Hs01_00133369 predicted 1938
7 SASI_Hs01_00133370 predicted 783
8 SASI_Hs01_00133371 predicted 1144
9 SASI_Hs01_00133372 predicted 1593
10 SASI_Hs01_00133373 predicted 2631
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109154 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00245660 predicted 1772
2 SASI_Rn02_00245661 predicted 678
3 SASI_Rn02_00245662 predicted 662
4 SASI_Rn02_00245663 predicted 2432
5 SASI_Rn02_00245664 predicted 1489
6 SASI_Rn02_00245665 predicted 1339
7 SASI_Rn02_00245666 predicted 694
8 SASI_Rn02_00245667 predicted 411
9 SASI_Rn02_00245668 predicted 1499
10 SASI_Rn02_00245669 predicted 2420
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138310 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00096212 predicted 1898
2 SASI_Mm01_00096213 predicted 1126
3 SASI_Mm01_00096214 predicted 1551
4 SASI_Mm01_00096215 predicted 1311
5 SASI_Mm01_00096216 predicted 2125
6 SASI_Mm01_00096218 predicted 1761
7 SASI_Mm01_00096219 predicted 1923
8 SASI_Mm01_00096220 predicted 2155
9 SASI_Mm01_00096221 predicted 1141
10 SASI_Mm02_00339611 predicted 1278
11 SASI_Mm01_00096217 predicted 2475
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138310
VALIDATED
APOBR MISSION shRNA Bacterial Glycerol Stock
apolipoprotein B receptor
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000104700    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138310.1-3281s1c1
Sequence:CCGGCGGCAACAGATCAGTTGCTTTCTCGAGAAAGCAACTGATCTGTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138310.1-662s1c1
Sequence:CCGGGCCAAAGACATGGTTGCAGAACTCGAGTTCTGCAACCATGTCTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138310.1-260s1c1
Sequence:CCGGGAAGGAAGTTTAGCTGGTGAACTCGAGTTCACCAGCTAAACTTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138310.1-1315s1c1
Sequence:CCGGCCAGATGACACCAGAGGTATTCTCGAGAATACCTCTGGTGTCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138310.1-1911s1c1
Sequence:CCGGCTGAGGAGATTATTGTGGGTACTCGAGTACCCACAATAATCTCCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138310.1-662s21c1
Sequence:CCGGGCCAAAGACATGGTTGCAGAACTCGAGTTCTGCAACCATGTCTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138310.1-1911s21c1
Sequence:CCGGCTGAGGAGATTATTGTGGGTACTCGAGTACCCACAATAATCTCCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327212    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138310.1-3281s21c1
Sequence:CCGGCGGCAACAGATCAGTTGCTTTCTCGAGAAAGCAACTGATCTGTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138310.1-260s21c1
Sequence:CCGGGAAGGAAGTTTAGCTGGTGAACTCGAGTTCACCAGCTAAACTTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138310.1-1315s21c1
Sequence:CCGGCCAGATGACACCAGAGGTATTCTCGAGAATACCTCTGGTGTCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138310
VALIDATED
APOBR MISSION shRNA shRNA Plasmid DNA
apolipoprotein B receptor
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000104700    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138310.1-3281s1c1
Sequence:CCGGCGGCAACAGATCAGTTGCTTTCTCGAGAAAGCAACTGATCTGTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138310.1-662s1c1
Sequence:CCGGGCCAAAGACATGGTTGCAGAACTCGAGTTCTGCAACCATGTCTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138310.1-260s1c1
Sequence:CCGGGAAGGAAGTTTAGCTGGTGAACTCGAGTTCACCAGCTAAACTTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138310.1-1315s1c1
Sequence:CCGGCCAGATGACACCAGAGGTATTCTCGAGAATACCTCTGGTGTCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138310.1-1911s1c1
Sequence:CCGGCTGAGGAGATTATTGTGGGTACTCGAGTACCCACAATAATCTCCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138310.1-662s21c1
Sequence:CCGGGCCAAAGACATGGTTGCAGAACTCGAGTTCTGCAACCATGTCTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138310.1-1911s21c1
Sequence:CCGGCTGAGGAGATTATTGTGGGTACTCGAGTACCCACAATAATCTCCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327212    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138310.1-3281s21c1
Sequence:CCGGCGGCAACAGATCAGTTGCTTTCTCGAGAAAGCAACTGATCTGTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138310.1-260s21c1
Sequence:CCGGGAAGGAAGTTTAGCTGGTGAACTCGAGTTCACCAGCTAAACTTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138310.1-1315s21c1
Sequence:CCGGCCAGATGACACCAGAGGTATTCTCGAGAATACCTCTGGTGTCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138310
VALIDATED
APOBR MISSION shRNA Lentiviral Transduction Particles
apolipoprotein B receptor
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000104700    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138310.1-3281s1c1
Sequence:CCGGCGGCAACAGATCAGTTGCTTTCTCGAGAAAGCAACTGATCTGTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138310.1-662s1c1
Sequence:CCGGGCCAAAGACATGGTTGCAGAACTCGAGTTCTGCAACCATGTCTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138310.1-260s1c1
Sequence:CCGGGAAGGAAGTTTAGCTGGTGAACTCGAGTTCACCAGCTAAACTTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138310.1-1315s1c1
Sequence:CCGGCCAGATGACACCAGAGGTATTCTCGAGAATACCTCTGGTGTCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138310.1-1911s1c1
Sequence:CCGGCTGAGGAGATTATTGTGGGTACTCGAGTACCCACAATAATCTCCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138310.1-662s21c1
Sequence:CCGGGCCAAAGACATGGTTGCAGAACTCGAGTTCTGCAACCATGTCTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138310.1-1911s21c1
Sequence:CCGGCTGAGGAGATTATTGTGGGTACTCGAGTACCCACAATAATCTCCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327212    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138310.1-3281s21c1
Sequence:CCGGCGGCAACAGATCAGTTGCTTTCTCGAGAAAGCAACTGATCTGTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138310.1-260s21c1
Sequence:CCGGGAAGGAAGTTTAGCTGGTGAACTCGAGTTCACCAGCTAAACTTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138310.1-1315s21c1
Sequence:CCGGCCAGATGACACCAGAGGTATTCTCGAGAATACCTCTGGTGTCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182804
APOBR MISSION shRNA Bacterial Glycerol Stock
apolipoprotein B receptor
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000060358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182804.1-1145s1c1
Sequence:CCGGCAGACTCAATATGGAGCAGTTCTCGAGAACTGCTCCATATTGAGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182804.1-260s1c1
Sequence:CCGGCCTGGAGATGACAGAAGACATCTCGAGATGTCTTCTGTCATCTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182804.1-1265s1c1
Sequence:CCGGGCCCAGGTCCTGGGCACTGAACTCGAGTTCAGTGCCCAGGACCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182804.1-1979s1c1
Sequence:CCGGCGAGAGTCTGAACTATCAGAACTCGAGTTCTGATAGTTCAGACTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182804.1-2630s1c1
Sequence:CCGGCTGTTGGAAGAAGAGGCTGTTCTCGAGAACAGCCTCTTCTTCCAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182804
APOBR MISSION shRNA shRNA Plasmid DNA
apolipoprotein B receptor
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000060358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182804.1-1145s1c1
Sequence:CCGGCAGACTCAATATGGAGCAGTTCTCGAGAACTGCTCCATATTGAGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182804.1-260s1c1
Sequence:CCGGCCTGGAGATGACAGAAGACATCTCGAGATGTCTTCTGTCATCTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182804.1-1265s1c1
Sequence:CCGGGCCCAGGTCCTGGGCACTGAACTCGAGTTCAGTGCCCAGGACCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182804.1-1979s1c1
Sequence:CCGGCGAGAGTCTGAACTATCAGAACTCGAGTTCTGATAGTTCAGACTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182804.1-2630s1c1
Sequence:CCGGCTGTTGGAAGAAGAGGCTGTTCTCGAGAACAGCCTCTTCTTCCAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182804
APOBR MISSION shRNA Lentiviral Transduction Particles
apolipoprotein B receptor
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000060358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182804.1-1145s1c1
Sequence:CCGGCAGACTCAATATGGAGCAGTTCTCGAGAACTGCTCCATATTGAGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182804.1-260s1c1
Sequence:CCGGCCTGGAGATGACAGAAGACATCTCGAGATGTCTTCTGTCATCTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182804.1-1265s1c1
Sequence:CCGGGCCCAGGTCCTGGGCACTGAACTCGAGTTCAGTGCCCAGGACCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182804.1-1979s1c1
Sequence:CCGGCGAGAGTCTGAACTATCAGAACTCGAGTTCTGATAGTTCAGACTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182804.1-2630s1c1
Sequence:CCGGCTGTTGGAAGAAGAGGCTGTTCTCGAGAACAGCCTCTTCTTCCAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks