EMAIL THIS PAGE TO A FRIEND

APOC1

apolipoprotein C-I

87 Gene Product Result for
UniProtKB ID: P02654, Q6IB97
Gene ID:
Human(341) Summary: The protein encoded by this gene is a member of the apolipoprotein C1 family. This gene is expressed primarily in the liver, and it is activated when monocytes differentiate into macrophages. A pseudogene of this gene is located 4 kb downstream in the same orientation, on the same chromosome. This gene is mapped to chromosome 19, where it resides within a apolipoprotein gene cluster. Alternatively spliced transcript variants have been found for this gene, but the biological validity of some variants has not been determined. [provided by RefSeq, Jul 2008]
Mouse(11812) apolipoprotein C-I
Rat(25292) apolipoprotein C-I
Domestic Rabbit(100301528) apolipoprotein C-I
domestic guinea pig(100718835) apolipoprotein C-I
naked mole-rat(101717774) apolipoprotein C-I
domestic cat(101086520) apolipoprotein C-I
cow(281633) apolipoprotein C-I
dog(476437) apolipoprotein C-I
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001645 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001645 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001645 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007469 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007469 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007469 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001645 Rosetta Predictions human pricing
NM_001109996 Rosetta Predictions rat pricing
NM_012824 Rosetta Predictions rat pricing
NM_001110009 Rosetta Predictions mouse pricing
NM_007469 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001645 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00203981 predicted 220
2 SASI_Hs01_00203982 predicted 197
3 SASI_Hs01_00203983 predicted 223
4 SASI_Hs01_00203984 predicted 236
5 SASI_Hs01_00203985 predicted 229
6 SASI_Hs01_00203986 predicted 237
7 SASI_Hs01_00203987 predicted 221
8 SASI_Hs01_00203988 predicted 230
9 SASI_Hs01_00203989 predicted 221
10 SASI_Hs01_00203990 predicted 199
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109996 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00250972 predicted 180
2 SASI_Rn02_00250973 predicted 199
3 SASI_Rn02_00250974 predicted 146
4 SASI_Rn02_00250975 predicted 302
5 SASI_Rn02_00250976 predicted 367
6 SASI_Rn02_00250977 predicted 205
7 SASI_Rn02_00250978 predicted 359
8 SASI_Rn02_00250979 predicted 223
9 SASI_Rn02_00250980 predicted 200
10 SASI_Rn02_00250981 predicted 320
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012824 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00091349 predicted 209
2 SASI_Rn01_00091350 predicted 215
3 SASI_Rn01_00091351 predicted 210
4 SASI_Rn01_00091352 predicted 206
5 SASI_Rn01_00091354 predicted 203
6 SASI_Rn01_00091353 predicted 208
7 SASI_Rn01_00091355 predicted 237
8 SASI_Rn01_00091356 predicted 176
9 SASI_Rn01_00091357 predicted 340
10 SASI_Rn02_00260275 predicted 400
11 SASI_Rn01_00091358 predicted 242
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110009 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00304574 predicted 195
2 SASI_Mm02_00304575 predicted 196
3 SASI_Mm02_00304576 predicted 354
4 SASI_Mm02_00304577 predicted 172
5 SASI_Mm02_00304578 predicted 189
6 SASI_Mm02_00304579 predicted 75
7 SASI_Mm02_00304580 predicted 283
8 SASI_Mm02_00304581 predicted 146
9 SASI_Mm02_00304582 predicted 152
10 SASI_Mm02_00304583 predicted 159
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007469 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00167801 predicted 252
2 SASI_Mm02_00311688 predicted 209
3 SASI_Mm02_00311689 predicted 214
4 SASI_Mm01_00167802 predicted 246
5 SASI_Mm01_00167803 predicted 224
6 SASI_Mm02_00311690 predicted 209
7 SASI_Mm01_00167805 predicted 232
8 SASI_Mm01_00167807 predicted 227
9 SASI_Mm01_00167808 predicted 244
10 SASI_Mm01_00167809 predicted 243
11 SASI_Mm01_00167800 predicted 216
12 SASI_Mm01_00167804 predicted 221
13 SASI_Mm01_00167806 predicted 223
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001645
VALIDATED
APOC1 MISSION shRNA Bacterial Glycerol Stock
apolipoprotein C-I
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001645.2-152s1c1
Sequence:CCGGCCTTGGATAAGCTGAAGGAGTCTCGAGACTCCTTCAGCTTATCCAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001645.2-171s1c1
Sequence:CCGGGTTTGGAAACACACTGGAGGACTCGAGTCCTCCAGTGTGTTTCCAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163118    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001645.2-202s1c1
Sequence:CCGGGAACTCATCAGCCGCATCAAACTCGAGTTTGATGCGGCTGATGAGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001645.2-264s1c1
Sequence:CCGGGACATTTCAGAAAGTGAAGGACTCGAGTCCTTCACTTTCTGAAATGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001645.2-215s1c1
Sequence:CCGGGCATCAAACAGAGTGAACTTTCTCGAGAAAGTTCACTCTGTTTGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001645.2-260s1c1
Sequence:CCGGCAGAGACATTTCAGAAAGTGACTCGAGTCACTTTCTGAAATGTCTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001645.2-266s1c1
Sequence:CCGGCATTTCAGAAAGTGAAGGAGACTCGAGTCTCCTTCACTTTCTGAAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001645.2-225s1c1
Sequence:CCGGGAGTGAACTTTCTGCCAAGATCTCGAGATCTTGGCAGAAAGTTCACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162089    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001645.2-214s1c1
Sequence:CCGGCGCATCAAACAGAGTGAACTTCTCGAGAAGTTCACTCTGTTTGATGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001645.2-162s1c1
Sequence:CCGGGCTGAAGGAGTTTGGAAACACCTCGAGGTGTTTCCAAACTCCTTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001645
VALIDATED
APOC1 MISSION shRNA shRNA Plasmid DNA
apolipoprotein C-I
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001645.2-152s1c1
Sequence:CCGGCCTTGGATAAGCTGAAGGAGTCTCGAGACTCCTTCAGCTTATCCAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001645.2-171s1c1
Sequence:CCGGGTTTGGAAACACACTGGAGGACTCGAGTCCTCCAGTGTGTTTCCAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163118    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001645.2-202s1c1
Sequence:CCGGGAACTCATCAGCCGCATCAAACTCGAGTTTGATGCGGCTGATGAGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001645.2-264s1c1
Sequence:CCGGGACATTTCAGAAAGTGAAGGACTCGAGTCCTTCACTTTCTGAAATGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001645.2-215s1c1
Sequence:CCGGGCATCAAACAGAGTGAACTTTCTCGAGAAAGTTCACTCTGTTTGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001645.2-260s1c1
Sequence:CCGGCAGAGACATTTCAGAAAGTGACTCGAGTCACTTTCTGAAATGTCTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001645.2-266s1c1
Sequence:CCGGCATTTCAGAAAGTGAAGGAGACTCGAGTCTCCTTCACTTTCTGAAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001645.2-225s1c1
Sequence:CCGGGAGTGAACTTTCTGCCAAGATCTCGAGATCTTGGCAGAAAGTTCACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162089    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001645.2-214s1c1
Sequence:CCGGCGCATCAAACAGAGTGAACTTCTCGAGAAGTTCACTCTGTTTGATGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001645.2-162s1c1
Sequence:CCGGGCTGAAGGAGTTTGGAAACACCTCGAGGTGTTTCCAAACTCCTTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001645
VALIDATED
APOC1 MISSION shRNA Lentiviral Transduction Particles
apolipoprotein C-I
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001645.2-152s1c1
Sequence:CCGGCCTTGGATAAGCTGAAGGAGTCTCGAGACTCCTTCAGCTTATCCAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001645.2-171s1c1
Sequence:CCGGGTTTGGAAACACACTGGAGGACTCGAGTCCTCCAGTGTGTTTCCAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163118    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001645.2-202s1c1
Sequence:CCGGGAACTCATCAGCCGCATCAAACTCGAGTTTGATGCGGCTGATGAGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001645.2-264s1c1
Sequence:CCGGGACATTTCAGAAAGTGAAGGACTCGAGTCCTTCACTTTCTGAAATGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001645.2-215s1c1
Sequence:CCGGGCATCAAACAGAGTGAACTTTCTCGAGAAAGTTCACTCTGTTTGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001645.2-260s1c1
Sequence:CCGGCAGAGACATTTCAGAAAGTGACTCGAGTCACTTTCTGAAATGTCTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001645.2-266s1c1
Sequence:CCGGCATTTCAGAAAGTGAAGGAGACTCGAGTCTCCTTCACTTTCTGAAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001645.2-225s1c1
Sequence:CCGGGAGTGAACTTTCTGCCAAGATCTCGAGATCTTGGCAGAAAGTTCACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162089    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001645.2-214s1c1
Sequence:CCGGCGCATCAAACAGAGTGAACTTCTCGAGAAGTTCACTCTGTTTGATGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001645.2-162s1c1
Sequence:CCGGGCTGAAGGAGTTTGGAAACACCTCGAGGTGTTTCCAAACTCCTTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007469
APOC1 MISSION shRNA Bacterial Glycerol Stock
apolipoprotein C-I
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000105085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007469.2-218s1c1
Sequence:CCGGCCGGATAAACTGAAGGAGTTTCTCGAGAAACTCCTTCAGTTTATCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007469.2-275s1c1
Sequence:CCGGGAACATATCAAACAGAAGGAACTCGAGTTCCTTCTGTTTGATATGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007469.2-143s1c1
Sequence:CCGGGTCGTAGCCATGACCTTGGAACTCGAGTTCCAAGGTCATGGCTACGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007469.2-187s1c1
Sequence:CCGGCCCGGATTTGTCCGGAACATTCTCGAGAATGTTCCGGACAAATCCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007469.2-266s1c1
Sequence:CCGGGCAGCCATTGAACATATCAAACTCGAGTTTGATATGTTCAATGGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007469
APOC1 MISSION shRNA shRNA Plasmid DNA
apolipoprotein C-I
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000105085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007469.2-218s1c1
Sequence:CCGGCCGGATAAACTGAAGGAGTTTCTCGAGAAACTCCTTCAGTTTATCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007469.2-275s1c1
Sequence:CCGGGAACATATCAAACAGAAGGAACTCGAGTTCCTTCTGTTTGATATGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007469.2-143s1c1
Sequence:CCGGGTCGTAGCCATGACCTTGGAACTCGAGTTCCAAGGTCATGGCTACGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007469.2-187s1c1
Sequence:CCGGCCCGGATTTGTCCGGAACATTCTCGAGAATGTTCCGGACAAATCCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007469.2-266s1c1
Sequence:CCGGGCAGCCATTGAACATATCAAACTCGAGTTTGATATGTTCAATGGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007469
APOC1 MISSION shRNA Lentiviral Transduction Particles
apolipoprotein C-I
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000105085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007469.2-218s1c1
Sequence:CCGGCCGGATAAACTGAAGGAGTTTCTCGAGAAACTCCTTCAGTTTATCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007469.2-275s1c1
Sequence:CCGGGAACATATCAAACAGAAGGAACTCGAGTTCCTTCTGTTTGATATGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007469.2-143s1c1
Sequence:CCGGGTCGTAGCCATGACCTTGGAACTCGAGTTCCAAGGTCATGGCTACGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007469.2-187s1c1
Sequence:CCGGCCCGGATTTGTCCGGAACATTCTCGAGAATGTTCCGGACAAATCCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007469.2-266s1c1
Sequence:CCGGGCAGCCATTGAACATATCAAACTCGAGTTTGATATGTTCAATGGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)