EMAIL THIS PAGE TO A FRIEND

APOC2

apolipoprotein C-II

56 Gene Product Result for
Synonyms: APO-CII APOC-II
UniProtKB ID: P02655, C0JYY4, Q9BS39, Q9UDE3, Q9UNK3
Gene ID:
Human(344) Summary: This gene encodes a lipid-binding protein belonging to the apolipoprotein gene family. The protein is secreted in plasma where it is a component of very low density lipoprotein. This protein activates the enzyme lipoprotein lipase, which hydrolyzes triglycerides and thus provides free fatty acids for cells. Mutations in this gene cause hyperlipoproteinemia type IB, characterized by hypertriglyceridemia, xanthomas, and increased risk of pancreatitis and early atherosclerosis. This gene is present in a cluster with other related apolipoprotein genes on chromosome 19. Naturally occurring read-through transcription exists between this gene and the neighboring upstream apolipoprotein C-IV (APOC4) gene. [provided by RefSeq, Mar 2011]
Mouse(11813) apolipoprotein C-II
Rat(292697) apolipoprotein C-II
Zebrafish(568972) apolipoprotein C-II
cow(618039) apolipoprotein C-II
domestic cat(101096861) apolipoprotein C-II
dog(442969) apolipoprotein C-II
domestic guinea pig(100135480) apolipoprotein C-II
sheep(101112082) apolipoprotein C-II
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB0612 Human APOC2 / Apolipoprotein C-II ELISA Kit human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009695 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009695 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009695 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000483 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000483 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000483 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU115791 MISSION® esiRNA esiRNA human APOC4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000483 Rosetta Predictions human pricing
NM_001085352 Rosetta Predictions rat pricing
NM_009695 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000483 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00234450 predicted 336
2 SASI_Hs01_00234451 predicted 262
3 SASI_Hs01_00234453 predicted 336
4 SASI_Hs01_00234454 predicted 373
5 SASI_Hs02_00302628 predicted 307
6 SASI_Hs02_00302629 predicted 260
7 SASI_Hs01_00234448 predicted 218
8 SASI_Hs01_00234449 predicted 261
9 SASI_Hs02_00302630 predicted 230
10 SASI_Hs01_00234452 predicted 282
11 SASI_Hs01_00234455 predicted 241
12 SASI_Hs01_00234456 predicted 205
13 SASI_Hs01_00234457 predicted 270
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001085352 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00208959 predicted 234
2 SASI_Rn02_00208960 predicted 209
3 SASI_Rn02_00208961 predicted 229
4 SASI_Rn02_00208962 predicted 234
5 SASI_Rn02_00208963 predicted 262
6 SASI_Rn02_00208964 predicted 252
7 SASI_Rn02_00208965 predicted 205
8 SASI_Rn02_00208966 predicted 251
9 SASI_Rn02_00208967 predicted 209
10 SASI_Rn02_00208968 predicted 211
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009695 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00167460 predicted 326
2 SASI_Mm01_00167462 predicted 267
3 SASI_Mm01_00167464 predicted 264
4 SASI_Mm01_00167466 predicted 303
5 SASI_Mm01_00167467 predicted 369
6 SASI_Mm01_00167468 predicted 378
7 SASI_Mm02_00316810 predicted 390
8 SASI_Mm02_00316811 predicted 344
9 SASI_Mm02_00316812 predicted 332
10 SASI_Mm02_00316813 predicted 257
11 SASI_Mm01_00167461 predicted 356
12 SASI_Mm01_00167463 predicted 261
13 SASI_Mm01_00167465 predicted 284
14 SASI_Mm01_00167469 predicted 450
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009695
VALIDATED
APOC2 MISSION shRNA Bacterial Glycerol Stock
apolipoprotein C-II
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000105082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009695.2-416s1c1
Sequence:CCGGGTACCAGAAGACATACCCGATCTCGAGATCGGGTATGTCTTCTGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009695.2-485s1c1
Sequence:CCGGCATGAGCACTTACGCAGGCATCTCGAGATGCCTGCGTAAGTGCTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009695.2-362s1c1
Sequence:CCGGGCAGGGCTCCCTCTTAAGTTACTCGAGTAACTTAAGAGGGAGCCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009695.2-285s1c1
Sequence:CCGGGTCATCCTGATGTTGGGAAATCTCGAGATTTCCCAACATCAGGATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009695.2-432s1c1
Sequence:CCGGCCGATCAGCATGGATGAGAAACTCGAGTTTCTCATCCATGCTGATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009695.3-389s21c1
Sequence:CCGGCATGAGCACTTACGCAGGCATCTCGAGATGCCTGCGTAAGTGCTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009695.3-320s21c1
Sequence:CCGGGTACCAGAAGACATACCCGATCTCGAGATCGGGTATGTCTTCTGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009695.3-189s21c1
Sequence:CCGGGTCATCCTGATGTTGGGAAATCTCGAGATTTCCCAACATCAGGATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009695.3-336s21c1
Sequence:CCGGCCGATCAGCATGGATGAGAAACTCGAGTTTCTCATCCATGCTGATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009695
VALIDATED
APOC2 MISSION shRNA shRNA Plasmid DNA
apolipoprotein C-II
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000105082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009695.2-416s1c1
Sequence:CCGGGTACCAGAAGACATACCCGATCTCGAGATCGGGTATGTCTTCTGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009695.2-485s1c1
Sequence:CCGGCATGAGCACTTACGCAGGCATCTCGAGATGCCTGCGTAAGTGCTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009695.2-362s1c1
Sequence:CCGGGCAGGGCTCCCTCTTAAGTTACTCGAGTAACTTAAGAGGGAGCCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009695.2-285s1c1
Sequence:CCGGGTCATCCTGATGTTGGGAAATCTCGAGATTTCCCAACATCAGGATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009695.2-432s1c1
Sequence:CCGGCCGATCAGCATGGATGAGAAACTCGAGTTTCTCATCCATGCTGATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009695.3-389s21c1
Sequence:CCGGCATGAGCACTTACGCAGGCATCTCGAGATGCCTGCGTAAGTGCTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009695.3-320s21c1
Sequence:CCGGGTACCAGAAGACATACCCGATCTCGAGATCGGGTATGTCTTCTGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009695.3-189s21c1
Sequence:CCGGGTCATCCTGATGTTGGGAAATCTCGAGATTTCCCAACATCAGGATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009695.3-336s21c1
Sequence:CCGGCCGATCAGCATGGATGAGAAACTCGAGTTTCTCATCCATGCTGATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009695
VALIDATED
APOC2 MISSION shRNA Lentiviral Transduction Particles
apolipoprotein C-II
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000105082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009695.2-416s1c1
Sequence:CCGGGTACCAGAAGACATACCCGATCTCGAGATCGGGTATGTCTTCTGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009695.2-485s1c1
Sequence:CCGGCATGAGCACTTACGCAGGCATCTCGAGATGCCTGCGTAAGTGCTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009695.2-362s1c1
Sequence:CCGGGCAGGGCTCCCTCTTAAGTTACTCGAGTAACTTAAGAGGGAGCCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009695.2-285s1c1
Sequence:CCGGGTCATCCTGATGTTGGGAAATCTCGAGATTTCCCAACATCAGGATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009695.2-432s1c1
Sequence:CCGGCCGATCAGCATGGATGAGAAACTCGAGTTTCTCATCCATGCTGATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009695.3-389s21c1
Sequence:CCGGCATGAGCACTTACGCAGGCATCTCGAGATGCCTGCGTAAGTGCTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009695.3-320s21c1
Sequence:CCGGGTACCAGAAGACATACCCGATCTCGAGATCGGGTATGTCTTCTGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009695.3-189s21c1
Sequence:CCGGGTCATCCTGATGTTGGGAAATCTCGAGATTTCCCAACATCAGGATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009695.3-336s21c1
Sequence:CCGGCCGATCAGCATGGATGAGAAACTCGAGTTTCTCATCCATGCTGATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000483
APOC2 MISSION shRNA Bacterial Glycerol Stock
apolipoprotein C-II
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000083833    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000483.3-510s1c1
Sequence:CCGGCTCCCAACTCTAGCCTGAATTCTCGAGAATTCAGGCTAGAGTTGGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000483.3-271s1c1
Sequence:CCGGGAACCTGTACGAGAAGACATACTCGAGTATGTCTTCTCGTACAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000483.3-180s1c1
Sequence:CCGGCCCAGCAAGATGAGATGCCTACTCGAGTAGGCATCTCATCTTGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000483.3-297s1c1
Sequence:CCGGCCGCTGTAGATGAGAAACTCACTCGAGTGAGTTTCTCATCTACAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000483.3-137s21c1
Sequence:CCGGGTCCTCCTGGTATTGGGATTTCTCGAGAAATCCCAATACCAGGAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000483.3-390s21c1
Sequence:CCGGTGCTGAAGGGAGAGGAGTAACCTCGAGGTTACTCCTCTCCCTTCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000483.3-239s21c1
Sequence:CCGGAGTTACTGGGAGTCAGCAAAGCTCGAGCTTTGCTGACTCCCAGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000483
APOC2 MISSION shRNA shRNA Plasmid DNA
apolipoprotein C-II
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000083833    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000483.3-510s1c1
Sequence:CCGGCTCCCAACTCTAGCCTGAATTCTCGAGAATTCAGGCTAGAGTTGGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000483.3-271s1c1
Sequence:CCGGGAACCTGTACGAGAAGACATACTCGAGTATGTCTTCTCGTACAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000483.3-180s1c1
Sequence:CCGGCCCAGCAAGATGAGATGCCTACTCGAGTAGGCATCTCATCTTGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000483.3-297s1c1
Sequence:CCGGCCGCTGTAGATGAGAAACTCACTCGAGTGAGTTTCTCATCTACAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000483.3-137s21c1
Sequence:CCGGGTCCTCCTGGTATTGGGATTTCTCGAGAAATCCCAATACCAGGAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000483.3-390s21c1
Sequence:CCGGTGCTGAAGGGAGAGGAGTAACCTCGAGGTTACTCCTCTCCCTTCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000483.3-239s21c1
Sequence:CCGGAGTTACTGGGAGTCAGCAAAGCTCGAGCTTTGCTGACTCCCAGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000483
APOC2 MISSION shRNA Lentiviral Transduction Particles
apolipoprotein C-II
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000083833    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000483.3-510s1c1
Sequence:CCGGCTCCCAACTCTAGCCTGAATTCTCGAGAATTCAGGCTAGAGTTGGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000483.3-271s1c1
Sequence:CCGGGAACCTGTACGAGAAGACATACTCGAGTATGTCTTCTCGTACAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000483.3-180s1c1
Sequence:CCGGCCCAGCAAGATGAGATGCCTACTCGAGTAGGCATCTCATCTTGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000483.3-297s1c1
Sequence:CCGGCCGCTGTAGATGAGAAACTCACTCGAGTGAGTTTCTCATCTACAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000483.3-137s21c1
Sequence:CCGGGTCCTCCTGGTATTGGGATTTCTCGAGAAATCCCAATACCAGGAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000483.3-390s21c1
Sequence:CCGGTGCTGAAGGGAGAGGAGTAACCTCGAGGTTACTCCTCTCCCTTCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000483.3-239s21c1
Sequence:CCGGAGTTACTGGGAGTCAGCAAAGCTCGAGCTTTGCTGACTCCCAGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks