EMAIL THIS PAGE TO A FRIEND

APOC3

apolipoprotein C-III

55 Gene Product Result for
Synonyms: APOCIII HALP2
UniProtKB ID: P02656, Q08E83, Q6Q786
Gene ID:
Human(345) Summary: Apolipoprotein C-III is a very low density lipoprotein (VLDL) protein. APOC3 inhibits lipoprotein lipase and hepatic lipase; it is thought to delay catabolism of triglyceride-rich particles. The APOA1, APOC3 and APOA4 genes are closely linked in both rat and human genomes. The A-I and A-IV genes are transcribed from the same strand, while the A-1 and C-III genes are convergently transcribed. An increase in apoC-III levels induces the development of hypertriglyceridemia. [provided by RefSeq, Jul 2008]
Mouse(11814) apolipoprotein C-III
Rat(24207) apolipoprotein C-III
domestic guinea pig(100135481) apolipoprotein C-III
naked mole-rat(101725083) apolipoprotein C-III
chicken(100859721) apolipoprotein C-III
domestic cat(101080822) apolipoprotein C-III
cow(408009) apolipoprotein C-III
dog(442970) apolipoprotein C-III
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB0618 Human APOC3 / Apolipoprotein C-III ELISA Kit human pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0461 AQUA Peptide DA[L]SSVQESQ human, mouse pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_023114 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023114 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023114 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000040 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000040 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000040 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU110451 MISSION® esiRNA esiRNA human APOC3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000040 Rosetta Predictions human pricing
NM_012501 Rosetta Predictions rat pricing
NM_023114 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000040 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00224083 predicted 305
2 SASI_Hs01_00224084 predicted 241
3 SASI_Hs01_00224085 predicted 251
4 SASI_Hs01_00224086 predicted 303
5 SASI_Hs01_00224088 predicted 264
6 SASI_Hs01_00224089 predicted 259
7 SASI_Hs01_00224090 predicted 251
8 SASI_Hs01_00224091 predicted 271
9 SASI_Hs01_00224092 predicted 230
10 SASI_Hs02_00301732 predicted 261
11 SASI_Hs01_00224087 predicted 242
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012501 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00110128 predicted 222
2 SASI_Rn01_00110130 predicted 232
3 SASI_Rn01_00110131 predicted 65
4 SASI_Rn02_00259553 predicted 115
5 SASI_Rn01_00110132 predicted 145
6 SASI_Rn01_00110133 predicted 215
7 SASI_Rn02_00259554 predicted 68
8 SASI_Rn01_00110134 predicted 204
9 SASI_Rn01_00110135 predicted 84
10 SASI_Rn01_00110136 predicted 183
11 SASI_Rn01_00110129 predicted 190
12 SASI_Rn01_00110137 predicted 226
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023114 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00115595 predicted 264
2 SASI_Mm02_00326793 predicted 197
3 SASI_Mm01_00115597 predicted 281
4 SASI_Mm02_00326794 predicted 292
5 SASI_Mm01_00115598 predicted 286
6 SASI_Mm01_00115600 predicted 249
7 SASI_Mm02_00326795 predicted 269
8 SASI_Mm01_00115602 predicted 201
9 SASI_Mm01_00115603 predicted 238
10 SASI_Mm01_00115604 predicted 230
11 SASI_Mm01_00115596 predicted 298
12 SASI_Mm01_00115599 predicted 235
13 SASI_Mm01_00115601 predicted 206
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023114
APOC3 MISSION shRNA Bacterial Glycerol Stock
apolipoprotein C-III
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000443957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023114.3-262s21c1
Sequence:CCGGGAAAGGCTACTGGAGCAAGTTCTCGAGAACTTGCTCCAGTAGCCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023114.3-234s21c1
Sequence:CCGGGCTGGATGGACAATCACTTCACTCGAGTGAAGTGATTGTCCATCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023114.3-350s21c1
Sequence:CCGGTGAGACTTCTGTGTTGCAGATCTCGAGATCTGCAACACAGAAGTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023114.3-197s21c1
Sequence:CCGGAGCGTGCAGGAGTCCGATATACTCGAGTATATCGGACTCCTGCACGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023114.3-113s21c1
Sequence:CCGGGAAGAGGTAGAGGGATCCTTGCTCGAGCAAGGATCCCTCTACCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023114.2-147s1c1
Sequence:CCGGGTACAGGGCTACATGGAACAACTCGAGTTGTTCCATGTAGCCCTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023114.2-275s1c1
Sequence:CCGGGAGCAAGTTTACTGACAAGTTCTCGAGAACTTGTCAGTAAACTTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023114.2-296s1c1
Sequence:CCGGCACCGGCTTCTGGGATTCTAACTCGAGTTAGAATCCCAGAAGCCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023114.2-178s1c1
Sequence:CCGGCGGTCCAGGATGCGCTAAGTACTCGAGTACTTAGCGCATCCTGGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023114
APOC3 MISSION shRNA shRNA Plasmid DNA
apolipoprotein C-III
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000443957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023114.3-262s21c1
Sequence:CCGGGAAAGGCTACTGGAGCAAGTTCTCGAGAACTTGCTCCAGTAGCCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023114.3-234s21c1
Sequence:CCGGGCTGGATGGACAATCACTTCACTCGAGTGAAGTGATTGTCCATCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023114.3-350s21c1
Sequence:CCGGTGAGACTTCTGTGTTGCAGATCTCGAGATCTGCAACACAGAAGTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023114.3-197s21c1
Sequence:CCGGAGCGTGCAGGAGTCCGATATACTCGAGTATATCGGACTCCTGCACGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023114.3-113s21c1
Sequence:CCGGGAAGAGGTAGAGGGATCCTTGCTCGAGCAAGGATCCCTCTACCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023114.2-147s1c1
Sequence:CCGGGTACAGGGCTACATGGAACAACTCGAGTTGTTCCATGTAGCCCTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023114.2-275s1c1
Sequence:CCGGGAGCAAGTTTACTGACAAGTTCTCGAGAACTTGTCAGTAAACTTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023114.2-296s1c1
Sequence:CCGGCACCGGCTTCTGGGATTCTAACTCGAGTTAGAATCCCAGAAGCCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023114.2-178s1c1
Sequence:CCGGCGGTCCAGGATGCGCTAAGTACTCGAGTACTTAGCGCATCCTGGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023114
APOC3 MISSION shRNA Lentiviral Transduction Particles
apolipoprotein C-III
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000443957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023114.3-262s21c1
Sequence:CCGGGAAAGGCTACTGGAGCAAGTTCTCGAGAACTTGCTCCAGTAGCCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023114.3-234s21c1
Sequence:CCGGGCTGGATGGACAATCACTTCACTCGAGTGAAGTGATTGTCCATCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023114.3-350s21c1
Sequence:CCGGTGAGACTTCTGTGTTGCAGATCTCGAGATCTGCAACACAGAAGTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023114.3-197s21c1
Sequence:CCGGAGCGTGCAGGAGTCCGATATACTCGAGTATATCGGACTCCTGCACGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023114.3-113s21c1
Sequence:CCGGGAAGAGGTAGAGGGATCCTTGCTCGAGCAAGGATCCCTCTACCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023114.2-147s1c1
Sequence:CCGGGTACAGGGCTACATGGAACAACTCGAGTTGTTCCATGTAGCCCTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023114.2-275s1c1
Sequence:CCGGGAGCAAGTTTACTGACAAGTTCTCGAGAACTTGTCAGTAAACTTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023114.2-296s1c1
Sequence:CCGGCACCGGCTTCTGGGATTCTAACTCGAGTTAGAATCCCAGAAGCCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023114.2-178s1c1
Sequence:CCGGCGGTCCAGGATGCGCTAAGTACTCGAGTACTTAGCGCATCCTGGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000040
APOC3 MISSION shRNA Bacterial Glycerol Stock
apolipoprotein C-III
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000419947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000040.1-148s21c1
Sequence:CCGGTTACATGAAGCACGCCACCAACTCGAGTTGGTGGCGTGCTTCATGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426825    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000040.1-363s21c1
Sequence:CCGGGTCCACCTGCCTATCCATCCTCTCGAGAGGATGGATAGGCAGGTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000040.1-338s21c1
Sequence:CCGGGCTGCCTGAGACCTCAATACCCTCGAGGGTATTGAGGTCTCAGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000040.1-268s1c1
Sequence:CCGGGAGCACCGTTAAGGACAAGTTCTCGAGAACTTGTCCTTAACGGTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000040.1-239s1c1
Sequence:CCGGGATGGCTTCAGTTCCCTGAAACTCGAGTTTCAGGGAACTGAAGCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000040.1-130s1c1
Sequence:CCGGTCTCAGCTTCATGCAGGGTTACTCGAGTAACCCTGCATGAAGCTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000040.1-286s1c1
Sequence:CCGGGTTCTCTGAGTTCTGGGATTTCTCGAGAAATCCCAGAACTCAGAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000040.1-270s1c1
Sequence:CCGGGCACCGTTAAGGACAAGTTCTCTCGAGAGAACTTGTCCTTAACGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000040
APOC3 MISSION shRNA shRNA Plasmid DNA
apolipoprotein C-III
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000419947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000040.1-148s21c1
Sequence:CCGGTTACATGAAGCACGCCACCAACTCGAGTTGGTGGCGTGCTTCATGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426825    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000040.1-363s21c1
Sequence:CCGGGTCCACCTGCCTATCCATCCTCTCGAGAGGATGGATAGGCAGGTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000040.1-338s21c1
Sequence:CCGGGCTGCCTGAGACCTCAATACCCTCGAGGGTATTGAGGTCTCAGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000040.1-268s1c1
Sequence:CCGGGAGCACCGTTAAGGACAAGTTCTCGAGAACTTGTCCTTAACGGTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000040.1-239s1c1
Sequence:CCGGGATGGCTTCAGTTCCCTGAAACTCGAGTTTCAGGGAACTGAAGCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000040.1-130s1c1
Sequence:CCGGTCTCAGCTTCATGCAGGGTTACTCGAGTAACCCTGCATGAAGCTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000040.1-286s1c1
Sequence:CCGGGTTCTCTGAGTTCTGGGATTTCTCGAGAAATCCCAGAACTCAGAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000040.1-270s1c1
Sequence:CCGGGCACCGTTAAGGACAAGTTCTCTCGAGAGAACTTGTCCTTAACGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000040
APOC3 MISSION shRNA Lentiviral Transduction Particles
apolipoprotein C-III
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000419947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000040.1-148s21c1
Sequence:CCGGTTACATGAAGCACGCCACCAACTCGAGTTGGTGGCGTGCTTCATGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426825    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000040.1-363s21c1
Sequence:CCGGGTCCACCTGCCTATCCATCCTCTCGAGAGGATGGATAGGCAGGTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000040.1-338s21c1
Sequence:CCGGGCTGCCTGAGACCTCAATACCCTCGAGGGTATTGAGGTCTCAGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000040.1-268s1c1
Sequence:CCGGGAGCACCGTTAAGGACAAGTTCTCGAGAACTTGTCCTTAACGGTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000040.1-239s1c1
Sequence:CCGGGATGGCTTCAGTTCCCTGAAACTCGAGTTTCAGGGAACTGAAGCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000040.1-130s1c1
Sequence:CCGGTCTCAGCTTCATGCAGGGTTACTCGAGTAACCCTGCATGAAGCTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000040.1-286s1c1
Sequence:CCGGGTTCTCTGAGTTCTGGGATTTCTCGAGAAATCCCAGAACTCAGAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000040.1-270s1c1
Sequence:CCGGGCACCGTTAAGGACAAGTTCTCTCGAGAGAACTTGTCCTTAACGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks