EMAIL THIS PAGE TO A FRIEND

APOC4

apolipoprotein C-IV

Synonyms: APO-CIV APOC-IV
UniProtKB ID: P55056, B3KWY6, Q53YY8
Gene ID:
Human(346) Summary: This gene encodes a lipid-binding protein belonging to the apolipoprotein gene family. The protein is thought to play a role in lipid metabolism. Polymorphisms in this gene may influence circulating lipid levels and may be associated with coronary artery disease risk. This gene is present in a cluster with other related apolipoprotein genes on chromosome 19. Naturally occurring read-through transcription exists between this gene and the neighboring downstream apolipoprotein C-II (APOC2) gene. [provided by RefSeq, Mar 2011]
Mouse(11425) apolipoprotein C-IV
Rat(680551) apolipoprotein C-IV
dog(612334) apolipoprotein C-IV
cow(618041) apolipoprotein C-IV
domestic cat(101086270) apolipoprotein C-IV
domestic guinea pig(100719109) apolipoprotein C-IV
sheep(101111825) apolipoprotein C-IV
Domestic Rabbit(100009218) apolipoprotein C-IV
44 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007385 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007385 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007385 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001646 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001646 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001646 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU004791 MISSION® esiRNA esiRNA targeting mouse Apoc4 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001646 Rosetta Predictions human pricing
NM_001109419 Rosetta Predictions rat pricing
NM_007385 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001646 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00034935 predicted 327
2 SASI_Hs01_00034936 predicted 333
3 SASI_Hs02_00332237 predicted 347
4 SASI_Hs01_00034937 predicted 241
5 SASI_Hs01_00034938 predicted 279
6 SASI_Hs01_00034939 predicted 335
7 SASI_Hs01_00034940 predicted 357
8 SASI_Hs01_00034941 predicted 235
9 SASI_Hs01_00034942 predicted 239
10 SASI_Hs01_00034944 predicted 311
11 SASI_Hs01_00034943 predicted 358
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109419 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00248227 predicted 218
2 SASI_Rn02_00248228 predicted 204
3 SASI_Rn02_00248229 predicted 221
4 SASI_Rn02_00248230 predicted 207
5 SASI_Rn02_00248231 predicted 280
6 SASI_Rn02_00248232 predicted 273
7 SASI_Rn02_00248233 predicted 73
8 SASI_Rn02_00248234 predicted 174
9 SASI_Rn02_00248235 predicted 410
10 SASI_Rn02_00248236 predicted 267
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007385 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00048623 predicted 198
2 SASI_Mm01_00048624 predicted 203
3 SASI_Mm01_00048625 predicted 276
4 SASI_Mm01_00048626 predicted 396
5 SASI_Mm01_00048627 predicted 272
6 SASI_Mm01_00048628 predicted 260
7 SASI_Mm01_00048629 predicted 258
8 SASI_Mm01_00048630 predicted 277
9 SASI_Mm01_00048631 predicted 170
10 SASI_Mm01_00048632 predicted 256
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007385
VALIDATED
APOC4 MISSION shRNA Bacterial Glycerol Stock
apolipoprotein C-IV
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000105205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007385.2-261s1c1
Sequence:CCGGCCAGGGCTTTATGCAGACCTACTCGAGTAGGTCTGCATAAAGCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007385.2-158s1c1
Sequence:CCGGGCAGCCGCTGGAGCCTGGTAACTCGAGTTACCAGGCTCCAGCGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007385.2-64s1c1
Sequence:CCGGGACCTGCCATCAGTCTCCCTTCTCGAGAAGGGAGACTGATGGCAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007385.2-101s1c1
Sequence:CCGGTCAGCTTTGTAGCATCCATGTCTCGAGACATGGATGCTACAAAGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007385.2-278s1c1
Sequence:CCGGCCTACTATGAAGATCACCTGACTCGAGTCAGGTGATCTTCATAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376083    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007385.2-117s21c1
Sequence:CCGGCATGTCTACAGAAAGCCTGAGCTCGAGCTCAGGCTTTCTGTAGACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007385.2-278s21c1
Sequence:CCGGCCTACTATGAAGATCACCTGACTCGAGTCAGGTGATCTTCATAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007385.2-64s21c1
Sequence:CCGGGACCTGCCATCAGTCTCCCTTCTCGAGAAGGGAGACTGATGGCAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007385.2-101s21c1
Sequence:CCGGTCAGCTTTGTAGCATCCATGTCTCGAGACATGGATGCTACAAAGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007385.2-252s21c1
Sequence:CCGGTGGAGCTGTCCAGGGCTTTATCTCGAGATAAAGCCCTGGACAGCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007385.2-212s21c1
Sequence:CCGGTGACCAGAACCAGGGACAGATCTCGAGATCTGTCCCTGGTTCTGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007385
VALIDATED
APOC4 MISSION shRNA shRNA Plasmid DNA
apolipoprotein C-IV
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000105205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007385.2-261s1c1
Sequence:CCGGCCAGGGCTTTATGCAGACCTACTCGAGTAGGTCTGCATAAAGCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007385.2-158s1c1
Sequence:CCGGGCAGCCGCTGGAGCCTGGTAACTCGAGTTACCAGGCTCCAGCGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007385.2-64s1c1
Sequence:CCGGGACCTGCCATCAGTCTCCCTTCTCGAGAAGGGAGACTGATGGCAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007385.2-101s1c1
Sequence:CCGGTCAGCTTTGTAGCATCCATGTCTCGAGACATGGATGCTACAAAGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007385.2-278s1c1
Sequence:CCGGCCTACTATGAAGATCACCTGACTCGAGTCAGGTGATCTTCATAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376083    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007385.2-117s21c1
Sequence:CCGGCATGTCTACAGAAAGCCTGAGCTCGAGCTCAGGCTTTCTGTAGACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007385.2-278s21c1
Sequence:CCGGCCTACTATGAAGATCACCTGACTCGAGTCAGGTGATCTTCATAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007385.2-64s21c1
Sequence:CCGGGACCTGCCATCAGTCTCCCTTCTCGAGAAGGGAGACTGATGGCAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007385.2-101s21c1
Sequence:CCGGTCAGCTTTGTAGCATCCATGTCTCGAGACATGGATGCTACAAAGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007385.2-252s21c1
Sequence:CCGGTGGAGCTGTCCAGGGCTTTATCTCGAGATAAAGCCCTGGACAGCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007385.2-212s21c1
Sequence:CCGGTGACCAGAACCAGGGACAGATCTCGAGATCTGTCCCTGGTTCTGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007385
VALIDATED
APOC4 MISSION shRNA Lentiviral Transduction Particles
apolipoprotein C-IV
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000105205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007385.2-261s1c1
Sequence:CCGGCCAGGGCTTTATGCAGACCTACTCGAGTAGGTCTGCATAAAGCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007385.2-158s1c1
Sequence:CCGGGCAGCCGCTGGAGCCTGGTAACTCGAGTTACCAGGCTCCAGCGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007385.2-64s1c1
Sequence:CCGGGACCTGCCATCAGTCTCCCTTCTCGAGAAGGGAGACTGATGGCAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007385.2-101s1c1
Sequence:CCGGTCAGCTTTGTAGCATCCATGTCTCGAGACATGGATGCTACAAAGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007385.2-278s1c1
Sequence:CCGGCCTACTATGAAGATCACCTGACTCGAGTCAGGTGATCTTCATAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376083    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007385.2-117s21c1
Sequence:CCGGCATGTCTACAGAAAGCCTGAGCTCGAGCTCAGGCTTTCTGTAGACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007385.2-278s21c1
Sequence:CCGGCCTACTATGAAGATCACCTGACTCGAGTCAGGTGATCTTCATAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007385.2-64s21c1
Sequence:CCGGGACCTGCCATCAGTCTCCCTTCTCGAGAAGGGAGACTGATGGCAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007385.2-101s21c1
Sequence:CCGGTCAGCTTTGTAGCATCCATGTCTCGAGACATGGATGCTACAAAGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007385.2-252s21c1
Sequence:CCGGTGGAGCTGTCCAGGGCTTTATCTCGAGATAAAGCCCTGGACAGCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007385.2-212s21c1
Sequence:CCGGTGACCAGAACCAGGGACAGATCTCGAGATCTGTCCCTGGTTCTGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001646
APOC4 MISSION shRNA Bacterial Glycerol Stock
apolipoprotein C-IV
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164082    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001646.1-337s1c1
Sequence:CCGGCTGGTTCCTCGAATCCAAAGACTCGAGTCTTTGGATTCGAGGAACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163969    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001646.1-346s1c1
Sequence:CCGGCGAATCCAAAGACAGCCTCTTCTCGAGAAGAGGCTGTCTTTGGATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163778    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001646.1-279s1c1
Sequence:CCGGGCTTCATGCAGACCTACTATGCTCGAGCATAGTAGGTCTGCATGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160807    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001646.1-159s1c1
Sequence:CCGGCAAAGCTAAAGATGAGTCGCTCTCGAGAGCGACTCATCTTTAGCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162174    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001646.1-352s1c1
Sequence:CCGGCAAAGACAGCCTCTTGAAGAACTCGAGTTCTTCAAGAGGCTGTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162554    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001646.1-280s1c1
Sequence:CCGGCTTCATGCAGACCTACTATGACTCGAGTCATAGTAGGTCTGCATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163728    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001646.1-347s1c1
Sequence:CCGGGAATCCAAAGACAGCCTCTTGCTCGAGCAAGAGGCTGTCTTTGGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001646.1-218s21c1
Sequence:CCGGACAGTGGTGAACAGGACCAGACTCGAGTCTGGTCCTGTTCACCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001646.1-405s21c1
Sequence:CCGGGGGACAAGGACCAGGGTTAAACTCGAGTTTAACCCTGGTCCTTGTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001646
APOC4 MISSION shRNA shRNA Plasmid DNA
apolipoprotein C-IV
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164082    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001646.1-337s1c1
Sequence:CCGGCTGGTTCCTCGAATCCAAAGACTCGAGTCTTTGGATTCGAGGAACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163969    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001646.1-346s1c1
Sequence:CCGGCGAATCCAAAGACAGCCTCTTCTCGAGAAGAGGCTGTCTTTGGATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163778    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001646.1-279s1c1
Sequence:CCGGGCTTCATGCAGACCTACTATGCTCGAGCATAGTAGGTCTGCATGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160807    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001646.1-159s1c1
Sequence:CCGGCAAAGCTAAAGATGAGTCGCTCTCGAGAGCGACTCATCTTTAGCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162174    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001646.1-352s1c1
Sequence:CCGGCAAAGACAGCCTCTTGAAGAACTCGAGTTCTTCAAGAGGCTGTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162554    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001646.1-280s1c1
Sequence:CCGGCTTCATGCAGACCTACTATGACTCGAGTCATAGTAGGTCTGCATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163728    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001646.1-347s1c1
Sequence:CCGGGAATCCAAAGACAGCCTCTTGCTCGAGCAAGAGGCTGTCTTTGGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001646.1-218s21c1
Sequence:CCGGACAGTGGTGAACAGGACCAGACTCGAGTCTGGTCCTGTTCACCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001646.1-405s21c1
Sequence:CCGGGGGACAAGGACCAGGGTTAAACTCGAGTTTAACCCTGGTCCTTGTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001646
APOC4 MISSION shRNA Lentiviral Transduction Particles
apolipoprotein C-IV
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164082    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001646.1-337s1c1
Sequence:CCGGCTGGTTCCTCGAATCCAAAGACTCGAGTCTTTGGATTCGAGGAACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163969    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001646.1-346s1c1
Sequence:CCGGCGAATCCAAAGACAGCCTCTTCTCGAGAAGAGGCTGTCTTTGGATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163778    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001646.1-279s1c1
Sequence:CCGGGCTTCATGCAGACCTACTATGCTCGAGCATAGTAGGTCTGCATGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160807    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001646.1-159s1c1
Sequence:CCGGCAAAGCTAAAGATGAGTCGCTCTCGAGAGCGACTCATCTTTAGCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162174    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001646.1-352s1c1
Sequence:CCGGCAAAGACAGCCTCTTGAAGAACTCGAGTTCTTCAAGAGGCTGTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162554    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001646.1-280s1c1
Sequence:CCGGCTTCATGCAGACCTACTATGACTCGAGTCATAGTAGGTCTGCATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163728    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001646.1-347s1c1
Sequence:CCGGGAATCCAAAGACAGCCTCTTGCTCGAGCAAGAGGCTGTCTTTGGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001646.1-218s21c1
Sequence:CCGGACAGTGGTGAACAGGACCAGACTCGAGTCTGGTCCTGTTCACCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001646.1-405s21c1
Sequence:CCGGGGGACAAGGACCAGGGTTAAACTCGAGTTTAACCCTGGTCCTTGTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks