EMAIL THIS PAGE TO A FRIEND

APOD

apolipoprotein D

67 Gene Product Result for
UniProtKB ID: P05090, B2R579, D3DNW6, Q6IBG6
Gene ID:
Human(347) Summary: This gene encodes a component of high density lipoprotein that has no marked similarity to other apolipoprotein sequences. It has a high degree of homology to plasma retinol-binding protein and other members of the alpha 2 microglobulin protein superfamily of carrier proteins, also known as lipocalins. This glycoprotein is closely associated with the enzyme lecithin:cholesterol acyltransferase - an enzyme involved in lipoprotein metabolism. [provided by RefSeq, Aug 2008]
Mouse(11815) apolipoprotein D
Rat(25239) apolipoprotein D
naked mole-rat(101723269) apolipoprotein D
sheep(101104361) apolipoprotein D
sheep(641308) apolipoprotein D
Domestic Rabbit(100009080) apolipoprotein D
Zebrafish(767642) apolipoprotein D
cow(613972) apolipoprotein D
domestic cat(101085232) apolipoprotein D
dog(478604) apolipoprotein D
chicken(424893) apolipoprotein D
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0463 AQUA Peptide VLNQEL[R] human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007470 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007470 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007470 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001647 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001647 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001647 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001647 Rosetta Predictions human pricing
NM_012777 Rosetta Predictions rat pricing
NM_007470 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001647 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00174746 predicted 462
2 SASI_Hs01_00174747 predicted 380
3 SASI_Hs01_00174748 predicted 398
4 SASI_Hs01_00174749 predicted 513
5 SASI_Hs02_00332238 predicted 507
6 SASI_Hs01_00174750 predicted 486
7 SASI_Hs01_00174751 predicted 466
8 SASI_Hs01_00174752 predicted 667
9 SASI_Hs02_00332239 predicted 422
10 SASI_Hs01_00174755 predicted 510
11 SASI_Hs01_00174753 predicted 665
12 SASI_Hs01_00174754 predicted 628
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012777 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00095087 predicted 255
2 SASI_Rn01_00095088 predicted 437
3 SASI_Rn01_00095089 predicted 271
4 SASI_Rn01_00095093 predicted 211
5 SASI_Rn01_00095094 predicted 422
6 SASI_Rn02_00260177 predicted 239
7 SASI_Rn02_00260178 predicted 265
8 SASI_Rn02_00260179 predicted 425
9 SASI_Rn01_00095095 predicted 527
10 SASI_Rn01_00095096 predicted 608
11 SASI_Rn01_00095090 predicted 287
12 SASI_Rn01_00095091 predicted 350
13 SASI_Rn01_00095092 predicted 392
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007470 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00311691 predicted 952
2 SASI_Mm02_00311692 predicted 331
3 SASI_Mm02_00311693 predicted 350
4 SASI_Mm02_00311694 predicted 312
5 SASI_Mm02_00311695 predicted 414
6 SASI_Mm02_00311696 predicted 999
7 SASI_Mm02_00311697 predicted 387
8 SASI_Mm02_00311698 predicted 949
9 SASI_Mm02_00311699 predicted 382
10 SASI_Mm02_00311700 predicted 306
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007470
APOD MISSION shRNA Bacterial Glycerol Stock
apolipoprotein D
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007470.3-461s21c1
Sequence:CCGGAGTCCAGTTCTTCCCGTTGATCTCGAGATCAACGGGAAGAACTGGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007470.3-395s21c1
Sequence:CCGGTGGAACCATGAACCAAGTAAACTCGAGTTTACTTGGTTCATGGTTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097805    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007470.1-728s1c1
Sequence:CCGGCGCCTCTTAAGTACCAAGCAACTCGAGTTGCTTGGTACTTAAGAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007470.1-215s1c1
Sequence:CCGGTCTTGGAAGATGGTACGAAATCTCGAGATTTCGTACCATCTTCCAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007470.1-332s1c1
Sequence:CCGGGAGTCCTGATGGAACCATGAACTCGAGTTCATGGTTCCATCAGGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007470.1-530s1c1
Sequence:CCGGGATTCTTGGAAGAAATCCTTACTCGAGTAAGGATTTCTTCCAAGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007470.1-558s1c1
Sequence:CCGGCCAGAAACAATAACCTACCTACTCGAGTAGGTAGGTTATTGTTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007470
APOD MISSION shRNA shRNA Plasmid DNA
apolipoprotein D
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007470.3-461s21c1
Sequence:CCGGAGTCCAGTTCTTCCCGTTGATCTCGAGATCAACGGGAAGAACTGGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007470.3-395s21c1
Sequence:CCGGTGGAACCATGAACCAAGTAAACTCGAGTTTACTTGGTTCATGGTTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097805    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007470.1-728s1c1
Sequence:CCGGCGCCTCTTAAGTACCAAGCAACTCGAGTTGCTTGGTACTTAAGAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007470.1-215s1c1
Sequence:CCGGTCTTGGAAGATGGTACGAAATCTCGAGATTTCGTACCATCTTCCAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007470.1-332s1c1
Sequence:CCGGGAGTCCTGATGGAACCATGAACTCGAGTTCATGGTTCCATCAGGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007470.1-530s1c1
Sequence:CCGGGATTCTTGGAAGAAATCCTTACTCGAGTAAGGATTTCTTCCAAGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007470.1-558s1c1
Sequence:CCGGCCAGAAACAATAACCTACCTACTCGAGTAGGTAGGTTATTGTTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007470
APOD MISSION shRNA Lentiviral Transduction Particles
apolipoprotein D
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007470.3-461s21c1
Sequence:CCGGAGTCCAGTTCTTCCCGTTGATCTCGAGATCAACGGGAAGAACTGGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007470.3-395s21c1
Sequence:CCGGTGGAACCATGAACCAAGTAAACTCGAGTTTACTTGGTTCATGGTTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097805    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007470.1-728s1c1
Sequence:CCGGCGCCTCTTAAGTACCAAGCAACTCGAGTTGCTTGGTACTTAAGAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007470.1-215s1c1
Sequence:CCGGTCTTGGAAGATGGTACGAAATCTCGAGATTTCGTACCATCTTCCAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007470.1-332s1c1
Sequence:CCGGGAGTCCTGATGGAACCATGAACTCGAGTTCATGGTTCCATCAGGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007470.1-530s1c1
Sequence:CCGGGATTCTTGGAAGAAATCCTTACTCGAGTAAGGATTTCTTCCAAGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007470.1-558s1c1
Sequence:CCGGCCAGAAACAATAACCTACCTACTCGAGTAGGTAGGTTATTGTTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001647
APOD MISSION shRNA Bacterial Glycerol Stock
apolipoprotein D
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000371276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001647.3-804s21c1
Sequence:CCGGATCTTGGCAAGAAACCCTAATCTCGAGATTAGGGTTTCTTGCCAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001647.3-611s21c1
Sequence:CCGGTGATGGAACTGTGAATCAAATCTCGAGATTTGATTCACAGTTCCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001647.1-274s1c1
Sequence:CCGGCGGAAAGATCAAAGTGTTAAACTCGAGTTTAACACTTTGATCTTTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001647.1-247s1c1
Sequence:CCGGCCAGGCCAACTACTCACTAATCTCGAGATTAGTGAGTAGTTGGCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001647.1-368s1c1
Sequence:CCGGGCCAAGCTGGAAGTTAAGTTTCTCGAGAAACTTAACTTCCAGCTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001647.1-177s1c1
Sequence:CCGGTGAATAAGTATCTCGGAAGATCTCGAGATCTTCCGAGATACTTATTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001647.1-425s1c1
Sequence:CCGGGCCACCGACTATGAGAACTATCTCGAGATAGTTCTCATAGTCGGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001647
APOD MISSION shRNA shRNA Plasmid DNA
apolipoprotein D
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000371276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001647.3-804s21c1
Sequence:CCGGATCTTGGCAAGAAACCCTAATCTCGAGATTAGGGTTTCTTGCCAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001647.3-611s21c1
Sequence:CCGGTGATGGAACTGTGAATCAAATCTCGAGATTTGATTCACAGTTCCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001647.1-274s1c1
Sequence:CCGGCGGAAAGATCAAAGTGTTAAACTCGAGTTTAACACTTTGATCTTTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001647.1-247s1c1
Sequence:CCGGCCAGGCCAACTACTCACTAATCTCGAGATTAGTGAGTAGTTGGCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001647.1-368s1c1
Sequence:CCGGGCCAAGCTGGAAGTTAAGTTTCTCGAGAAACTTAACTTCCAGCTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001647.1-177s1c1
Sequence:CCGGTGAATAAGTATCTCGGAAGATCTCGAGATCTTCCGAGATACTTATTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001647.1-425s1c1
Sequence:CCGGGCCACCGACTATGAGAACTATCTCGAGATAGTTCTCATAGTCGGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001647
APOD MISSION shRNA Lentiviral Transduction Particles
apolipoprotein D
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000371276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001647.3-804s21c1
Sequence:CCGGATCTTGGCAAGAAACCCTAATCTCGAGATTAGGGTTTCTTGCCAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001647.3-611s21c1
Sequence:CCGGTGATGGAACTGTGAATCAAATCTCGAGATTTGATTCACAGTTCCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001647.1-274s1c1
Sequence:CCGGCGGAAAGATCAAAGTGTTAAACTCGAGTTTAACACTTTGATCTTTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001647.1-247s1c1
Sequence:CCGGCCAGGCCAACTACTCACTAATCTCGAGATTAGTGAGTAGTTGGCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001647.1-368s1c1
Sequence:CCGGGCCAAGCTGGAAGTTAAGTTTCTCGAGAAACTTAACTTCCAGCTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001647.1-177s1c1
Sequence:CCGGTGAATAAGTATCTCGGAAGATCTCGAGATCTTCCGAGATACTTATTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001647.1-425s1c1
Sequence:CCGGGCCACCGACTATGAGAACTATCTCGAGATAGTTCTCATAGTCGGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks