EMAIL THIS PAGE TO A FRIEND

APOE

apolipoprotein E

86 Gene Product Result for
Synonyms: AD2 LDLCQ5 LPG
UniProtKB ID: P02649, B2RC15, C0JYY5, Q9P2S4
Gene ID:
Human(348) Summary: Chylomicron remnants and very low density lipoprotein (VLDL) remnants are rapidly removed from the circulation by receptor-mediated endocytosis in the liver. Apolipoprotein E, a main apoprotein of the chylomicron, binds to a specific receptor on liver cells and peripheral cells. ApoE is essential for the normal catabolism of triglyceride-rich lipoprotein constituents. The APOE gene is mapped to chromosome 19 in a cluster with APOC1 and APOC2. Defects in apolipoprotein E result in familial dysbetalipoproteinemia, or type III hyperlipoproteinemia (HLP III), in which increased plasma cholesterol and triglycerides are the consequence of impaired clearance of chylomicron and VLDL remnants. [provided by RefSeq, Jul 2008]
Mouse(11816) apolipoprotein E
Rat(25728) apolipoprotein E
cow(281004) apolipoprotein E
domestic cat(101086769) apolipoprotein E
dog(476438) apolipoprotein E
Domestic Rabbit(100009337) apolipoprotein E
naked mole-rat(101717206) apolipoprotein E
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009696 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009696 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009696 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000041 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000041 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000041 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU031371 MISSION® esiRNA esiRNA targeting mouse Apoe (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000041 Rosetta Predictions human pricing
NM_138828 Rosetta Predictions rat pricing
NM_009696 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000041 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00154592 predicted 253
2 SASI_Hs01_00154599 predicted 237
3 SASI_Hs01_00154590 predicted 337
4 SASI_Hs01_00154591 predicted 343
5 SASI_Hs01_00154593 predicted 319
6 SASI_Hs01_00154594 predicted 350
7 SASI_Hs01_00154595 predicted 896
8 SASI_Hs01_00154596 predicted 352
9 SASI_Hs01_00154597 predicted 305
10 SASI_Hs01_00154598 predicted 910
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138828 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00268202 predicted 257
2 SASI_Rn01_00094698 predicted 252
3 SASI_Rn02_00268203 predicted 688
4 SASI_Rn02_00268204 predicted 856
5 SASI_Rn02_00268205 predicted 852
6 SASI_Rn02_00268206 predicted 249
7 SASI_Rn02_00268207 predicted 781
8 SASI_Rn02_00268208 predicted 852
9 SASI_Rn02_00268209 predicted 235
10 SASI_Rn01_00094704 predicted 748
11 SASI_Rn01_00094696 predicted 372
12 SASI_Rn01_00094697 predicted 231
13 SASI_Rn01_00094699 predicted 381
14 SASI_Rn01_00094700 predicted 553
15 SASI_Rn01_00094701 predicted 459
16 SASI_Rn01_00094702 predicted 474
17 SASI_Rn01_00094703 predicted 472
18 SASI_Rn01_00094705 predicted 382
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009696 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00152575 predicted 397
2 SASI_Mm01_00152577 predicted 390
3 SASI_Mm02_00316814 predicted 244
4 SASI_Mm01_00152578 predicted 560
5 SASI_Mm02_00316815 predicted 390
6 SASI_Mm02_00316816 predicted 334
7 SASI_Mm01_00152581 predicted 595
8 SASI_Mm01_00152582 predicted 371
9 SASI_Mm02_00316817 predicted 566
10 SASI_Mm01_00152583 predicted 552
11 SASI_Mm01_00152574 predicted 497
12 SASI_Mm01_00152576 predicted 592
13 SASI_Mm01_00152579 predicted 863
14 SASI_Mm01_00152580 predicted 851
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009696
VALIDATED
APOE MISSION shRNA Bacterial Glycerol Stock
apolipoprotein E
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000011799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009696.2-162s1c1
Sequence:CCGGCCTGAACCGCTTCTGGGATTACTCGAGTAATCCCAGAAGCGGTTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009696.2-870s1c1
Sequence:CCGGCGAGCCAATAGTGGAAGACATCTCGAGATGTCTTCCACTATTGGCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009696.2-792s1c1
Sequence:CCGGGCGCTCCAAGATGGAGGAACACTCGAGTGTTCCTCCATCTTGGAGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009696.2-268s1c1
Sequence:CCGGGAGGACACTATGACGGAAGTACTCGAGTACTTCCGTCATAGTGTCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009696.2-279s1c1
Sequence:CCGGGACGGAAGTAAAGGCTTACAACTCGAGTTGTAAGCCTTTACTTCCGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009696.3-1094s21c1
Sequence:CCGGAGTGGCCCAGGAGAATCAATGCTCGAGCATTGATTCTCCTGGGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009696.3-402s21c1
Sequence:CCGGGAGGACACTATGACGGAAGTACTCGAGTACTTCCGTCATAGTGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009696.3-296s21c1
Sequence:CCGGCCTGAACCGCTTCTGGGATTACTCGAGTAATCCCAGAAGCGGTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009696.3-635s21c1
Sequence:CCGGCAAGATGCGCAAGCGCTTGATCTCGAGATCAAGCGCTTGCGCATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000284913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009696.3-413s21c1
Sequence:CCGGGACGGAAGTAAAGGCTTACAACTCGAGTTGTAAGCCTTTACTTCCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009696
VALIDATED
APOE MISSION shRNA shRNA Plasmid DNA
apolipoprotein E
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000011799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009696.2-162s1c1
Sequence:CCGGCCTGAACCGCTTCTGGGATTACTCGAGTAATCCCAGAAGCGGTTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009696.2-870s1c1
Sequence:CCGGCGAGCCAATAGTGGAAGACATCTCGAGATGTCTTCCACTATTGGCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009696.2-792s1c1
Sequence:CCGGGCGCTCCAAGATGGAGGAACACTCGAGTGTTCCTCCATCTTGGAGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009696.2-268s1c1
Sequence:CCGGGAGGACACTATGACGGAAGTACTCGAGTACTTCCGTCATAGTGTCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009696.2-279s1c1
Sequence:CCGGGACGGAAGTAAAGGCTTACAACTCGAGTTGTAAGCCTTTACTTCCGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009696.3-1094s21c1
Sequence:CCGGAGTGGCCCAGGAGAATCAATGCTCGAGCATTGATTCTCCTGGGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009696.3-402s21c1
Sequence:CCGGGAGGACACTATGACGGAAGTACTCGAGTACTTCCGTCATAGTGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009696.3-296s21c1
Sequence:CCGGCCTGAACCGCTTCTGGGATTACTCGAGTAATCCCAGAAGCGGTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009696.3-635s21c1
Sequence:CCGGCAAGATGCGCAAGCGCTTGATCTCGAGATCAAGCGCTTGCGCATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000284913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009696.3-413s21c1
Sequence:CCGGGACGGAAGTAAAGGCTTACAACTCGAGTTGTAAGCCTTTACTTCCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009696
VALIDATED
APOE MISSION shRNA Lentiviral Transduction Particles
apolipoprotein E
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000011799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009696.2-162s1c1
Sequence:CCGGCCTGAACCGCTTCTGGGATTACTCGAGTAATCCCAGAAGCGGTTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009696.2-870s1c1
Sequence:CCGGCGAGCCAATAGTGGAAGACATCTCGAGATGTCTTCCACTATTGGCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009696.2-792s1c1
Sequence:CCGGGCGCTCCAAGATGGAGGAACACTCGAGTGTTCCTCCATCTTGGAGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009696.2-268s1c1
Sequence:CCGGGAGGACACTATGACGGAAGTACTCGAGTACTTCCGTCATAGTGTCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009696.2-279s1c1
Sequence:CCGGGACGGAAGTAAAGGCTTACAACTCGAGTTGTAAGCCTTTACTTCCGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009696.3-1094s21c1
Sequence:CCGGAGTGGCCCAGGAGAATCAATGCTCGAGCATTGATTCTCCTGGGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009696.3-402s21c1
Sequence:CCGGGAGGACACTATGACGGAAGTACTCGAGTACTTCCGTCATAGTGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009696.3-296s21c1
Sequence:CCGGCCTGAACCGCTTCTGGGATTACTCGAGTAATCCCAGAAGCGGTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009696.3-635s21c1
Sequence:CCGGCAAGATGCGCAAGCGCTTGATCTCGAGATCAAGCGCTTGCGCATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000284913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009696.3-413s21c1
Sequence:CCGGGACGGAAGTAAAGGCTTACAACTCGAGTTGTAAGCCTTTACTTCCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000041
APOE MISSION shRNA Bacterial Glycerol Stock
apolipoprotein E
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000010913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000041.1-318s1c1
Sequence:CCGGGAAGGAGTTGAAGGCCTACAACTCGAGTTGTAGGCCTTCAACTCCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000041.1-891s1c1
Sequence:CCGGCCGCCTCAAGAGCTGGTTCGACTCGAGTCGAACCAGCTCTTGAGGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000041.1-234s1c1
Sequence:CCGGGCAGACACTGTCTGAGCAGGTCTCGAGACCTGCTCAGACAGTGTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000041.2-323s21c1
Sequence:CCGGGCTGATGGACGAGACCATGAACTCGAGTTCATGGTCTCGTCCATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000041.2-1018s21c1
Sequence:CCGGTGCCCAGCGACAATCACTGAACTCGAGTTCAGTGATTGTCGCTGGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000041.2-331s21c1
Sequence:CCGGACGAGACCATGAAGGAGTTGACTCGAGTCAACTCCTTCATGGTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000041.2-350s21c1
Sequence:CCGGGAAGGCCTACAAATCGGAACTCTCGAGAGTTCCGATTTGTAGGCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000041.2-1026s21c1
Sequence:CCGGGACAATCACTGAACGCCGAAGCTCGAGCTTCGGCGTTCAGTGATTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000041
APOE MISSION shRNA shRNA Plasmid DNA
apolipoprotein E
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000010913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000041.1-318s1c1
Sequence:CCGGGAAGGAGTTGAAGGCCTACAACTCGAGTTGTAGGCCTTCAACTCCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000041.1-891s1c1
Sequence:CCGGCCGCCTCAAGAGCTGGTTCGACTCGAGTCGAACCAGCTCTTGAGGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000041.1-234s1c1
Sequence:CCGGGCAGACACTGTCTGAGCAGGTCTCGAGACCTGCTCAGACAGTGTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000041.2-323s21c1
Sequence:CCGGGCTGATGGACGAGACCATGAACTCGAGTTCATGGTCTCGTCCATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000041.2-1018s21c1
Sequence:CCGGTGCCCAGCGACAATCACTGAACTCGAGTTCAGTGATTGTCGCTGGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000041.2-331s21c1
Sequence:CCGGACGAGACCATGAAGGAGTTGACTCGAGTCAACTCCTTCATGGTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000041.2-350s21c1
Sequence:CCGGGAAGGCCTACAAATCGGAACTCTCGAGAGTTCCGATTTGTAGGCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000041.2-1026s21c1
Sequence:CCGGGACAATCACTGAACGCCGAAGCTCGAGCTTCGGCGTTCAGTGATTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000041
APOE MISSION shRNA Lentiviral Transduction Particles
apolipoprotein E
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000010913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000041.1-318s1c1
Sequence:CCGGGAAGGAGTTGAAGGCCTACAACTCGAGTTGTAGGCCTTCAACTCCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000041.1-891s1c1
Sequence:CCGGCCGCCTCAAGAGCTGGTTCGACTCGAGTCGAACCAGCTCTTGAGGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000041.1-234s1c1
Sequence:CCGGGCAGACACTGTCTGAGCAGGTCTCGAGACCTGCTCAGACAGTGTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000041.2-323s21c1
Sequence:CCGGGCTGATGGACGAGACCATGAACTCGAGTTCATGGTCTCGTCCATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000041.2-1018s21c1
Sequence:CCGGTGCCCAGCGACAATCACTGAACTCGAGTTCAGTGATTGTCGCTGGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000041.2-331s21c1
Sequence:CCGGACGAGACCATGAAGGAGTTGACTCGAGTCAACTCCTTCATGGTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000041.2-350s21c1
Sequence:CCGGGAAGGCCTACAAATCGGAACTCTCGAGAGTTCCGATTTGTAGGCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000041.2-1026s21c1
Sequence:CCGGGACAATCACTGAACGCCGAAGCTCGAGCTTCGGCGTTCAGTGATTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks