EMAIL THIS PAGE TO A FRIEND

APOF

apolipoprotein F

51 Gene Product Result for
Synonyms: Apo-F LTIP
UniProtKB ID: Q13790, Q8TC13
Gene ID:
Human(319) Summary: The product of this gene is one of the minor apolipoproteins found in plasma. This protein forms complexes with lipoproteins and may be involved in transport and/or esterification of cholesterol. [provided by RefSeq, Jul 2008]
Mouse(103161) apolipoprotein F
Rat(500761) apolipoprotein F
Zebrafish(793418) apolipoprotein F
cow(539595) apolipoprotein F
domestic cat(101086159) apolipoprotein F
dog(474405) apolipoprotein F
naked mole-rat(101719803) apolipoprotein F
sheep(101102138) apolipoprotein F
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133997 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133997 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133997 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001638 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001638 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001638 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001638 Rosetta Predictions human pricing
NM_001024351 Rosetta Predictions rat pricing
NM_133997 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001638 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00096944 predicted 819
2 SASI_Hs01_00096945 predicted 699
3 SASI_Hs01_00096946 predicted 548
4 SASI_Hs01_00096947 predicted 236
5 SASI_Hs01_00096948 predicted 778
6 SASI_Hs01_00096949 predicted 578
7 SASI_Hs01_00096950 predicted 340
8 SASI_Hs01_00096951 predicted 292
9 SASI_Hs01_00096952 predicted 751
10 SASI_Hs01_00096953 predicted 763
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024351 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00073276 predicted 540
2 SASI_Rn01_00073277 predicted 770
3 SASI_Rn02_00202580 predicted 779
4 SASI_Rn01_00073278 predicted 701
5 SASI_Rn01_00073279 predicted 572
6 SASI_Rn01_00073280 predicted 456
7 SASI_Rn01_00073281 predicted 708
8 SASI_Rn01_00073282 predicted 533
9 SASI_Rn01_00073283 predicted 756
10 SASI_Rn02_00202581 predicted 652
11 SASI_Rn01_00073284 predicted 292
12 SASI_Rn01_00073285 predicted 651
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133997 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00198993 predicted 1521
2 SASI_Mm01_00198994 predicted 1473
3 SASI_Mm01_00198996 predicted 1156
4 SASI_Mm01_00198997 predicted 797
5 SASI_Mm01_00198998 predicted 1404
6 SASI_Mm02_00339139 predicted 1612
7 SASI_Mm01_00198999 predicted 1271
8 SASI_Mm01_00199000 predicted 902
9 SASI_Mm01_00199001 predicted 1296
10 SASI_Mm01_00199002 predicted 1340
11 SASI_Mm01_00198995 predicted 1247
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133997
APOF MISSION shRNA Bacterial Glycerol Stock
apolipoprotein F
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000444250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133997.2-1261s21c1
Sequence:CCGGCAACACAGACTGCGACAATGACTCGAGTCATTGTCGCAGTCTGTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133997.2-1478s21c1
Sequence:CCGGGTGATCACGGCTGCTCTTAAGCTCGAGCTTAAGAGCAGCCGTGATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099435    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133997.1-1771s1c1
Sequence:CCGGACAAGAGAAGTGTAGATGGATCTCGAGATCCATCTACACTTCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133997.1-1524s1c1
Sequence:CCGGCGGCTGATCCAGTATTATTATCTCGAGATAATAATACTGGATCAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133997.1-902s1c1
Sequence:CCGGCCCTCCCTCGAAGTTGGGATACTCGAGTATCCCAACTTCGAGGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133997.1-1351s1c1
Sequence:CCGGCAGCTTTGTATTACGCCATTACTCGAGTAATGGCGTAATACAAAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133997
APOF MISSION shRNA shRNA Plasmid DNA
apolipoprotein F
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000444250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133997.2-1261s21c1
Sequence:CCGGCAACACAGACTGCGACAATGACTCGAGTCATTGTCGCAGTCTGTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133997.2-1478s21c1
Sequence:CCGGGTGATCACGGCTGCTCTTAAGCTCGAGCTTAAGAGCAGCCGTGATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099435    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133997.1-1771s1c1
Sequence:CCGGACAAGAGAAGTGTAGATGGATCTCGAGATCCATCTACACTTCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133997.1-1524s1c1
Sequence:CCGGCGGCTGATCCAGTATTATTATCTCGAGATAATAATACTGGATCAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133997.1-902s1c1
Sequence:CCGGCCCTCCCTCGAAGTTGGGATACTCGAGTATCCCAACTTCGAGGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133997.1-1351s1c1
Sequence:CCGGCAGCTTTGTATTACGCCATTACTCGAGTAATGGCGTAATACAAAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133997
APOF MISSION shRNA Lentiviral Transduction Particles
apolipoprotein F
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000444250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133997.2-1261s21c1
Sequence:CCGGCAACACAGACTGCGACAATGACTCGAGTCATTGTCGCAGTCTGTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133997.2-1478s21c1
Sequence:CCGGGTGATCACGGCTGCTCTTAAGCTCGAGCTTAAGAGCAGCCGTGATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099435    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133997.1-1771s1c1
Sequence:CCGGACAAGAGAAGTGTAGATGGATCTCGAGATCCATCTACACTTCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133997.1-1524s1c1
Sequence:CCGGCGGCTGATCCAGTATTATTATCTCGAGATAATAATACTGGATCAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133997.1-902s1c1
Sequence:CCGGCCCTCCCTCGAAGTTGGGATACTCGAGTATCCCAACTTCGAGGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133997.1-1351s1c1
Sequence:CCGGCAGCTTTGTATTACGCCATTACTCGAGTAATGGCGTAATACAAAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001638
APOF MISSION shRNA Bacterial Glycerol Stock
apolipoprotein F
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000371280    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001638.2-1041s21c1
Sequence:CCGGTGTGGTAACCACAGAATTAATCTCGAGATTAATTCTGTGGTTACCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371279    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001638.2-1068s21c1
Sequence:CCGGACTACCCTGACAAGCTATATACTCGAGTATATAGCTTGTCAGGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001638.2-782s21c1
Sequence:CCGGCTGCACTTAAACCTGCATTAACTCGAGTTAATGCAGGTTTAAGTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001638.1-830s1c1
Sequence:CCGGCCAAGATCAGAAAGACGCAAACTCGAGTTTGCGTCTTTCTGATCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001638.1-922s1c1
Sequence:CCGGCTACTCTGGCTTCTTTCATATCTCGAGATATGAAAGAAGCCAGAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001638.1-160s1c1
Sequence:CCGGCTTCATATGGAAAGCAGACAACTCGAGTTGTCTGCTTTCCATATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001638.1-813s1c1
Sequence:CCGGCAGTTGATCCAGTATTACCAACTCGAGTTGGTAATACTGGATCAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001638.1-904s1c1
Sequence:CCGGGTGACTTGGAAGAAACAACTACTCGAGTAGTTGTTTCTTCCAAGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001638
APOF MISSION shRNA shRNA Plasmid DNA
apolipoprotein F
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000371280    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001638.2-1041s21c1
Sequence:CCGGTGTGGTAACCACAGAATTAATCTCGAGATTAATTCTGTGGTTACCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371279    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001638.2-1068s21c1
Sequence:CCGGACTACCCTGACAAGCTATATACTCGAGTATATAGCTTGTCAGGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001638.2-782s21c1
Sequence:CCGGCTGCACTTAAACCTGCATTAACTCGAGTTAATGCAGGTTTAAGTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001638.1-830s1c1
Sequence:CCGGCCAAGATCAGAAAGACGCAAACTCGAGTTTGCGTCTTTCTGATCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001638.1-922s1c1
Sequence:CCGGCTACTCTGGCTTCTTTCATATCTCGAGATATGAAAGAAGCCAGAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001638.1-160s1c1
Sequence:CCGGCTTCATATGGAAAGCAGACAACTCGAGTTGTCTGCTTTCCATATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001638.1-813s1c1
Sequence:CCGGCAGTTGATCCAGTATTACCAACTCGAGTTGGTAATACTGGATCAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001638.1-904s1c1
Sequence:CCGGGTGACTTGGAAGAAACAACTACTCGAGTAGTTGTTTCTTCCAAGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001638
APOF MISSION shRNA Lentiviral Transduction Particles
apolipoprotein F
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000371280    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001638.2-1041s21c1
Sequence:CCGGTGTGGTAACCACAGAATTAATCTCGAGATTAATTCTGTGGTTACCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371279    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001638.2-1068s21c1
Sequence:CCGGACTACCCTGACAAGCTATATACTCGAGTATATAGCTTGTCAGGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001638.2-782s21c1
Sequence:CCGGCTGCACTTAAACCTGCATTAACTCGAGTTAATGCAGGTTTAAGTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001638.1-830s1c1
Sequence:CCGGCCAAGATCAGAAAGACGCAAACTCGAGTTTGCGTCTTTCTGATCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001638.1-922s1c1
Sequence:CCGGCTACTCTGGCTTCTTTCATATCTCGAGATATGAAAGAAGCCAGAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001638.1-160s1c1
Sequence:CCGGCTTCATATGGAAAGCAGACAACTCGAGTTGTCTGCTTTCCATATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001638.1-813s1c1
Sequence:CCGGCAGTTGATCCAGTATTACCAACTCGAGTTGGTAATACTGGATCAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001638.1-904s1c1
Sequence:CCGGGTGACTTGGAAGAAACAACTACTCGAGTAGTTGTTTCTTCCAAGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks