EMAIL THIS PAGE TO A FRIEND

APOH

apolipoprotein H (beta-2-glycoprotein I)

73 Gene Product Result for
Synonyms: B2G1 B2GP1 BG
UniProtKB ID: P02749, B2R9M3, Q9UCN7
Gene ID:
Human(350) Summary: Apolipoprotein H has been implicated in a variety of physiologic pathways including lipoprotein metabolism, coagulation, and the production of antiphospholipid autoantibodies. APOH may be a required cofactor for anionic phospholipid binding by the antiphospholipid autoantibodies found in sera of many patients with lupus and primary antiphospholipid syndrome, but it does not seem to be required for the reactivity of antiphospholipid autoantibodies associated with infections. [provided by RefSeq, Jul 2008]
Mouse(11818) apolipoprotein H
Rat(287774) apolipoprotein H (beta-2-glycoprotein I)
sheep(101117521) apolipoprotein H (beta-2-glycoprotein I)
naked mole-rat(101716619) apolipoprotein H (beta-2-glycoprotein I)
chicken(417431) apolipoprotein H (beta-2-glycoprotein I)
domestic cat(101080593) apolipoprotein H (beta-2-glycoprotein I)
dog(403945) apolipoprotein H (beta-2-glycoprotein I)
cow(281006) apolipoprotein H (beta-2-glycoprotein I)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB0617 Human APOH / Beta-2-glycoprotein 1 ELISA Kit human pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0472 AQUA Peptide ATVVYQGE[R] human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013475 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013475 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013475 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000042 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000042 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000042 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000042 Rosetta Predictions human pricing
NM_001009626 Rosetta Predictions rat pricing
NM_013475 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000042 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00038179 predicted 623
2 SASI_Hs01_00038180 predicted 498
3 SASI_Hs01_00038181 predicted 646
4 SASI_Hs02_00301733 predicted 548
5 SASI_Hs01_00038182 predicted 246
6 SASI_Hs01_00038183 predicted 880
7 SASI_Hs01_00038184 predicted 621
8 SASI_Hs01_00038186 predicted 689
9 SASI_Hs01_00038187 predicted 689
10 SASI_Hs01_00038188 predicted 408
11 SASI_Hs01_00038185 predicted 870
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009626 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00108954 predicted 746
2 SASI_Rn01_00108956 predicted 285
3 SASI_Rn02_00199632 predicted 915
4 SASI_Rn01_00108959 predicted 326
5 SASI_Rn01_00108961 predicted 223
6 SASI_Rn01_00108963 predicted 788
7 SASI_Rn02_00199633 predicted 693
8 SASI_Rn02_00199634 predicted 330
9 SASI_Rn02_00199635 predicted 780
10 SASI_Rn02_00199636 predicted 876
11 SASI_Rn01_00108955 predicted 873
12 SASI_Rn01_00108957 predicted 723
13 SASI_Rn01_00108958 predicted 231
14 SASI_Rn01_00108960 predicted 602
15 SASI_Rn01_00108962 predicted 574
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013475 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00067354 predicted 230
2 SASI_Mm01_00067355 predicted 569
3 SASI_Mm01_00067356 predicted 480
4 SASI_Mm01_00067357 predicted 319
5 SASI_Mm01_00067358 predicted 228
6 SASI_Mm02_00322114 predicted 688
7 SASI_Mm02_00322115 predicted 598
8 SASI_Mm01_00067359 predicted 488
9 SASI_Mm01_00067360 predicted 287
10 SASI_Mm02_00322116 predicted 784
11 SASI_Mm01_00067361 predicted 899
12 SASI_Mm01_00067362 predicted 773
13 SASI_Mm01_00067363 predicted 626
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013475
APOH MISSION shRNA Bacterial Glycerol Stock
apolipoprotein H (beta-2-glycoprotein I)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000101040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013475.1-108s1c1
Sequence:CCGGCGGATGACCTACCATTTGCTACTCGAGTAGCAAATGGTAGGTCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013475.1-470s1c1
Sequence:CCGGGTTCCAAAGTTTGCACTCCTTCTCGAGAAGGAGTGCAAACTTTGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013475.1-526s1c1
Sequence:CCGGGTATCAGGACACAGTGGTCTTCTCGAGAAGACCACTGTGTCCTGATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013475.1-695s1c1
Sequence:CCGGCCGGTGCTTCTATATAAGGATCTCGAGATCCTTATATAGAAGCACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013475.1-696s1c1
Sequence:CCGGCGGTGCTTCTATATAAGGATACTCGAGTATCCTTATATAGAAGCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013475
APOH MISSION shRNA shRNA Plasmid DNA
apolipoprotein H (beta-2-glycoprotein I)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000101040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013475.1-108s1c1
Sequence:CCGGCGGATGACCTACCATTTGCTACTCGAGTAGCAAATGGTAGGTCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013475.1-470s1c1
Sequence:CCGGGTTCCAAAGTTTGCACTCCTTCTCGAGAAGGAGTGCAAACTTTGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013475.1-526s1c1
Sequence:CCGGGTATCAGGACACAGTGGTCTTCTCGAGAAGACCACTGTGTCCTGATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013475.1-695s1c1
Sequence:CCGGCCGGTGCTTCTATATAAGGATCTCGAGATCCTTATATAGAAGCACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013475.1-696s1c1
Sequence:CCGGCGGTGCTTCTATATAAGGATACTCGAGTATCCTTATATAGAAGCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013475
APOH MISSION shRNA Lentiviral Transduction Particles
apolipoprotein H (beta-2-glycoprotein I)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000101040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013475.1-108s1c1
Sequence:CCGGCGGATGACCTACCATTTGCTACTCGAGTAGCAAATGGTAGGTCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013475.1-470s1c1
Sequence:CCGGGTTCCAAAGTTTGCACTCCTTCTCGAGAAGGAGTGCAAACTTTGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013475.1-526s1c1
Sequence:CCGGGTATCAGGACACAGTGGTCTTCTCGAGAAGACCACTGTGTCCTGATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013475.1-695s1c1
Sequence:CCGGCCGGTGCTTCTATATAAGGATCTCGAGATCCTTATATAGAAGCACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013475.1-696s1c1
Sequence:CCGGCGGTGCTTCTATATAAGGATACTCGAGTATCCTTATATAGAAGCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000042
VALIDATED
APOH MISSION shRNA Bacterial Glycerol Stock
apolipoprotein H (beta-2-glycoprotein I)
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000083869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000042.1-479s1c1
Sequence:CCGGCGTTTGCAACACTTCGTGTTTCTCGAGAAACACGAAGTGTTGCAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000042.1-599s1c1
Sequence:CCGGCGACACATGGAAATTGGACTACTCGAGTAGTCCAATTTCCATGTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000042.1-674s1c1
Sequence:CCGGGATTTGTGAACTATCCTGCAACTCGAGTTGCAGGATAGTTCACAAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_000042.1-510s1c1
Sequence:CCGGAGCTGGAAACAATTCCCTCTACTCGAGTAGAGGGAATTGTTTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_000042.1-160s1c1
Sequence:CCGGCCAGGAGAAGAGATTACGTATCTCGAGATACGTAATCTCTTCTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000042.2-401s21c1
Sequence:CCGGTTATCTGAATGGCGCTGATTCCTCGAGGAATCAGCGCCATTCAGATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_000042.2-923s21c1
Sequence:CCGGTGGAATGCTACATGGTGATAACTCGAGTTATCACCATGTAGCATTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000042.2-505s21c1
Sequence:CCGGCGTTTGCAACACTTCGTGTTTCTCGAGAAACACGAAGTGTTGCAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000042.2-152s21c1
Sequence:CCGGTTCCACAGTGGTCCCGTTAAACTCGAGTTTAACGGGACCACTGTGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000042.2-186s21c1
Sequence:CCGGCCAGGAGAAGAGATTACGTATCTCGAGATACGTAATCTCTTCTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_000042.2-755s21c1
Sequence:CCGGTGGCTGCCATGATGGATATTCCTCGAGGAATATCCATCATGGCAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000042
VALIDATED
APOH MISSION shRNA shRNA Plasmid DNA
apolipoprotein H (beta-2-glycoprotein I)
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000083869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000042.1-479s1c1
Sequence:CCGGCGTTTGCAACACTTCGTGTTTCTCGAGAAACACGAAGTGTTGCAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000042.1-599s1c1
Sequence:CCGGCGACACATGGAAATTGGACTACTCGAGTAGTCCAATTTCCATGTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000042.1-674s1c1
Sequence:CCGGGATTTGTGAACTATCCTGCAACTCGAGTTGCAGGATAGTTCACAAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_000042.1-510s1c1
Sequence:CCGGAGCTGGAAACAATTCCCTCTACTCGAGTAGAGGGAATTGTTTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_000042.1-160s1c1
Sequence:CCGGCCAGGAGAAGAGATTACGTATCTCGAGATACGTAATCTCTTCTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000042.2-401s21c1
Sequence:CCGGTTATCTGAATGGCGCTGATTCCTCGAGGAATCAGCGCCATTCAGATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_000042.2-923s21c1
Sequence:CCGGTGGAATGCTACATGGTGATAACTCGAGTTATCACCATGTAGCATTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000042.2-505s21c1
Sequence:CCGGCGTTTGCAACACTTCGTGTTTCTCGAGAAACACGAAGTGTTGCAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000042.2-152s21c1
Sequence:CCGGTTCCACAGTGGTCCCGTTAAACTCGAGTTTAACGGGACCACTGTGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000042.2-186s21c1
Sequence:CCGGCCAGGAGAAGAGATTACGTATCTCGAGATACGTAATCTCTTCTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_000042.2-755s21c1
Sequence:CCGGTGGCTGCCATGATGGATATTCCTCGAGGAATATCCATCATGGCAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000042
VALIDATED
APOH MISSION shRNA Lentiviral Transduction Particles
apolipoprotein H (beta-2-glycoprotein I)
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000083869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000042.1-479s1c1
Sequence:CCGGCGTTTGCAACACTTCGTGTTTCTCGAGAAACACGAAGTGTTGCAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000042.1-599s1c1
Sequence:CCGGCGACACATGGAAATTGGACTACTCGAGTAGTCCAATTTCCATGTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000042.1-674s1c1
Sequence:CCGGGATTTGTGAACTATCCTGCAACTCGAGTTGCAGGATAGTTCACAAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_000042.1-510s1c1
Sequence:CCGGAGCTGGAAACAATTCCCTCTACTCGAGTAGAGGGAATTGTTTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_000042.1-160s1c1
Sequence:CCGGCCAGGAGAAGAGATTACGTATCTCGAGATACGTAATCTCTTCTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000042.2-401s21c1
Sequence:CCGGTTATCTGAATGGCGCTGATTCCTCGAGGAATCAGCGCCATTCAGATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_000042.2-923s21c1
Sequence:CCGGTGGAATGCTACATGGTGATAACTCGAGTTATCACCATGTAGCATTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000042.2-505s21c1
Sequence:CCGGCGTTTGCAACACTTCGTGTTTCTCGAGAAACACGAAGTGTTGCAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000042.2-152s21c1
Sequence:CCGGTTCCACAGTGGTCCCGTTAAACTCGAGTTTAACGGGACCACTGTGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000042.2-186s21c1
Sequence:CCGGCCAGGAGAAGAGATTACGTATCTCGAGATACGTAATCTCTTCTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_000042.2-755s21c1
Sequence:CCGGTGGCTGCCATGATGGATATTCCTCGAGGAATATCCATCATGGCAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks