EMAIL THIS PAGE TO A FRIEND

APOL1

apolipoprotein L, 1

41 Gene Product Result for
Synonyms: APO-L APOL APOL-I FSGS4
Species: Human APOL1(8542), Zebrafish apol1(560340)
Gene ID:
Human(8542) Summary: This gene encodes a secreted high density lipoprotein which binds to apolipoprotein A-I. Apolipoprotein A-I is a relatively abundant plasma protein and is the major apoprotein of HDL. It is involved in the formation of most cholesteryl esters in plasma and also promotes efflux of cholesterol from cells. This apolipoprotein L family member may play a role in lipid exchange and transport throughout the body, as well as in reverse cholesterol transport from peripheral cells to the liver. Several different transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2008]
Zebrafish(560340) apolipoprotein L, 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2500087 Anti-APOL1 antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, western blot pricing
SAB2502001 Anti-APOL1 antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, western blot pricing
SAB1406681 Anti-APOL1 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
HPA018885 Anti-APOL1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB4503412 Anti-APOL1 antibody produced in rabbit affinity isolated antibody human
ELISA, western blot pricing
SAB1411534 Anti-APOL1 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB5300144 Monoclonal Anti-APOL1 antibody produced in mouse clone 1D4, ascites fluid human
ELISA, western blot pricing
AMAB90530 Monoclonal Anti-APOL1 antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL0171, purified immunoglobulin, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
AMAB90529 Monoclonal Anti-APOL1 antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL0170, purified immunoglobulin, buffered aqueous glycerol solution human
western blot pricing
AMAB90532 Monoclonal Anti-APOL1 antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL0173, purified immunoglobulin, buffered aqueous glycerol solution human
western blot pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0466 AQUA Peptide LNILNNNY[K] human pricing
AQ0464 AQUA Peptide VTEPISAESGEQVE[R] human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003661 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003661 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003661 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU134541 MISSION® esiRNA esiRNA human APOL1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003661 Rosetta Predictions human pricing
NM_145343 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003661 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00187646 predicted 501
2 SASI_Hs01_00187648 predicted 560
3 SASI_Hs01_00187649 predicted 410
4 SASI_Hs02_00336042 predicted 954
5 SASI_Hs01_00187651 predicted 508
6 SASI_Hs01_00187652 predicted 831
7 SASI_Hs01_00187653 predicted 498
8 SASI_Hs01_00187654 predicted 352
9 SASI_Hs01_00187655 predicted 704
10 SASI_Hs02_00336043 predicted 817
11 SASI_Hs01_00187647 predicted 515
12 SASI_Hs01_00187650 predicted 610
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145343 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00178795 predicted 654
2 SASI_Hs01_00178797 predicted 713
3 SASI_Hs01_00178798 predicted 564
4 SASI_Hs02_00365239 predicted 1108
5 SASI_Hs01_00178800 predicted 669
6 SASI_Hs01_00178801 predicted 989
7 SASI_Hs01_00178802 predicted 659
8 SASI_Hs01_00178803 predicted 506
9 SASI_Hs01_00178804 predicted 851
10 SASI_Hs02_00365240 predicted 972
11 SASI_Hs01_00178796 predicted 676
12 SASI_Hs01_00178799 predicted 760
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003661
APOL1 MISSION shRNA Bacterial Glycerol Stock
apolipoprotein L, 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000377712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003661.3-1114s21c1
Sequence:CCGGGAACAGGTGGAGAGGGTTAATCTCGAGATTAACCCTCTCCACCTGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003661.3-944s21c1
Sequence:CCGGGTGAGAACATATCCAACTTTCCTCGAGGAAAGTTGGATATGTTCTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003661.3-421s21c1
Sequence:CCGGCTACTCCTGCTGACTGATAATCTCGAGATTATCAGTCAGCAGGAGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118632    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003661.2-2408s1c1
Sequence:CCGGCCTCCGAAGAATGAAGTCTTTCTCGAGAAAGACTTCATTCTTCGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003661.2-372s1c1
Sequence:CCGGGCCATTAAGTATTTCAAGGAACTCGAGTTCCTTGAAATACTTAATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003661.2-1293s1c1
Sequence:CCGGCTGGAGGAGAAGCTAAACATTCTCGAGAATGTTTAGCTTCTCCTCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003661.2-358s1c1
Sequence:CCGGTCTTTATTGAGGATGCCATTACTCGAGTAATGGCATCCTCAATAAAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003661.2-1217s1c1
Sequence:CCGGCGTGTACGAATCAAAGCACTTCTCGAGAAGTGCTTTGATTCGTACACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003661
APOL1 MISSION shRNA shRNA Plasmid DNA
apolipoprotein L, 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000377712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003661.3-1114s21c1
Sequence:CCGGGAACAGGTGGAGAGGGTTAATCTCGAGATTAACCCTCTCCACCTGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000371337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003661.3-944s21c1
Sequence:CCGGGTGAGAACATATCCAACTTTCCTCGAGGAAAGTTGGATATGTTCTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000377713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003661.3-421s21c1
Sequence:CCGGCTACTCCTGCTGACTGATAATCTCGAGATTATCAGTCAGCAGGAGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118632    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003661.2-2408s1c1
Sequence:CCGGCCTCCGAAGAATGAAGTCTTTCTCGAGAAAGACTTCATTCTTCGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003661.2-372s1c1
Sequence:CCGGGCCATTAAGTATTTCAAGGAACTCGAGTTCCTTGAAATACTTAATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003661.2-1293s1c1
Sequence:CCGGCTGGAGGAGAAGCTAAACATTCTCGAGAATGTTTAGCTTCTCCTCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003661.2-358s1c1
Sequence:CCGGTCTTTATTGAGGATGCCATTACTCGAGTAATGGCATCCTCAATAAAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003661.2-1217s1c1
Sequence:CCGGCGTGTACGAATCAAAGCACTTCTCGAGAAGTGCTTTGATTCGTACACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003661
APOL1 MISSION shRNA Lentiviral Transduction Particles
apolipoprotein L, 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000377712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003661.3-1114s21c1
Sequence:CCGGGAACAGGTGGAGAGGGTTAATCTCGAGATTAACCCTCTCCACCTGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003661.3-944s21c1
Sequence:CCGGGTGAGAACATATCCAACTTTCCTCGAGGAAAGTTGGATATGTTCTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003661.3-421s21c1
Sequence:CCGGCTACTCCTGCTGACTGATAATCTCGAGATTATCAGTCAGCAGGAGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118632    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003661.2-2408s1c1
Sequence:CCGGCCTCCGAAGAATGAAGTCTTTCTCGAGAAAGACTTCATTCTTCGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003661.2-372s1c1
Sequence:CCGGGCCATTAAGTATTTCAAGGAACTCGAGTTCCTTGAAATACTTAATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003661.2-1293s1c1
Sequence:CCGGCTGGAGGAGAAGCTAAACATTCTCGAGAATGTTTAGCTTCTCCTCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003661.2-358s1c1
Sequence:CCGGTCTTTATTGAGGATGCCATTACTCGAGTAATGGCATCCTCAATAAAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003661.2-1217s1c1
Sequence:CCGGCGTGTACGAATCAAAGCACTTCTCGAGAAGTGCTTTGATTCGTACACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)