EMAIL THIS PAGE TO A FRIEND

APOL2

apolipoprotein L, 2

90 Gene Product Result for
Synonyms: APOL-II APOL3
Gene ID:
Human(23780) Summary: This gene is a member of the apolipoprotein L gene family. The encoded protein is found in the cytoplasm, where it may affect the movement of lipids or allow the binding of lipids to organelles. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
Rat(315111) apolipoprotein L, 2
cow(619179) apolipoprotein L, 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030882 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030882 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030882 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU045301 MISSION® esiRNA esiRNA human APOL2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030882 Rosetta Predictions human pricing
NM_145637 Rosetta Predictions human pricing
XM_001075828 Rosetta Predictions rat pricing
XM_235465 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030882 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00056254 predicted 824
2 SASI_Hs01_00056256 predicted 945
3 SASI_Hs01_00056257 predicted 878
4 SASI_Hs01_00056258 predicted 994
5 SASI_Hs01_00056260 predicted 401
6 SASI_Hs01_00056261 predicted 936
7 SASI_Hs01_00056262 predicted 1061
8 SASI_Hs02_00358414 predicted 692
9 SASI_Hs02_00358415 predicted 1060
10 SASI_Hs01_00056263 predicted 1095
11 SASI_Hs01_00056255 predicted 695
12 SASI_Hs01_00056259 predicted 1182
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145637 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00240346 predicted 967
2 SASI_Hs01_00240348 predicted 1079
3 SASI_Hs01_00240349 predicted 1020
4 SASI_Hs01_00240350 predicted 1137
5 SASI_Hs01_00240352 predicted 545
6 SASI_Hs01_00240353 predicted 1070
7 SASI_Hs01_00240354 predicted 1200
8 SASI_Hs02_00365254 predicted 833
9 SASI_Hs02_00365255 predicted 1201
10 SASI_Hs01_00240355 predicted 1242
11 SASI_Hs01_00240347 predicted 833
12 SASI_Hs01_00240351 predicted 1321
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001075828 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00351207 predicted 290
2 SASI_Rn02_00351208 predicted 548
3 SASI_Rn02_00351209 predicted 607
4 SASI_Rn02_00351210 predicted 766
5 SASI_Rn02_00351211 predicted 209
6 SASI_Rn02_00351212 predicted 756
7 SASI_Rn02_00351213 predicted 605
8 SASI_Rn02_00351214 predicted 351
9 SASI_Rn02_00351215 predicted 726
10 SASI_Rn02_00351216 predicted 553
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_235465 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00389339 predicted 282
2 SASI_Rn02_00389340 predicted 547
3 SASI_Rn02_00389341 predicted 605
4 SASI_Rn02_00389342 predicted 762
5 SASI_Rn02_00389343 predicted 211
6 SASI_Rn02_00389344 predicted 750
7 SASI_Rn02_00389345 predicted 606
8 SASI_Rn02_00389346 predicted 353
9 SASI_Rn02_00389347 predicted 720
10 SASI_Rn02_00389348 predicted 549
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030882
VALIDATED
APOL2 MISSION shRNA Bacterial Glycerol Stock
apolipoprotein L, 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000310235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_030882.2-889s21c1
Sequence:CCGGGACCAAAGCGGCACCAATGTACTCGAGTACATTGGTGCCGCTTTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_030882.2-951s21c1
Sequence:CCGGTGTTCTTACCTTAGTTGACAACTCGAGTTGTCAACTAAGGTAAGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_030882.2-1296s21c1
Sequence:CCGGGCTCAACTTTCTCACCAAGATCTCGAGATCTTGGTGAGAAAGTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_030882.2-362s21c1
Sequence:CCGGTTGAGGATTACCTTAAGTATTCTCGAGAATACTTAAGGTAATCCTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_030882.2-833s21c1
Sequence:CCGGGCAGTGTGGTAGAACTAGTAACTCGAGTTACTAGTTCTACCACACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083103    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_030882.2-2103s1c1
Sequence:CCGGCCTTCCAAGAATAAAGTCTTTCTCGAGAAAGACTTTATTCTTGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_030882.2-951s1c1
Sequence:CCGGTGTTCTTACCTTAGTTGACAACTCGAGTTGTCAACTAAGGTAAGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_030882.2-1296s1c1
Sequence:CCGGGCTCAACTTTCTCACCAAGATCTCGAGATCTTGGTGAGAAAGTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_030882.2-833s1c1
Sequence:CCGGGCAGTGTGGTAGAACTAGTAACTCGAGTTACTAGTTCTACCACACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030882.2-1062s1c1
Sequence:CCGGCCCGCATATCATTGGGCGAATCTCGAGATTCGCCCAATGATATGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030882
VALIDATED
APOL2 MISSION shRNA shRNA Plasmid DNA
apolipoprotein L, 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000310235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_030882.2-889s21c1
Sequence:CCGGGACCAAAGCGGCACCAATGTACTCGAGTACATTGGTGCCGCTTTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_030882.2-951s21c1
Sequence:CCGGTGTTCTTACCTTAGTTGACAACTCGAGTTGTCAACTAAGGTAAGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_030882.2-1296s21c1
Sequence:CCGGGCTCAACTTTCTCACCAAGATCTCGAGATCTTGGTGAGAAAGTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_030882.2-362s21c1
Sequence:CCGGTTGAGGATTACCTTAAGTATTCTCGAGAATACTTAAGGTAATCCTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_030882.2-833s21c1
Sequence:CCGGGCAGTGTGGTAGAACTAGTAACTCGAGTTACTAGTTCTACCACACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083103    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_030882.2-2103s1c1
Sequence:CCGGCCTTCCAAGAATAAAGTCTTTCTCGAGAAAGACTTTATTCTTGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_030882.2-951s1c1
Sequence:CCGGTGTTCTTACCTTAGTTGACAACTCGAGTTGTCAACTAAGGTAAGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_030882.2-1296s1c1
Sequence:CCGGGCTCAACTTTCTCACCAAGATCTCGAGATCTTGGTGAGAAAGTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_030882.2-833s1c1
Sequence:CCGGGCAGTGTGGTAGAACTAGTAACTCGAGTTACTAGTTCTACCACACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030882.2-1062s1c1
Sequence:CCGGCCCGCATATCATTGGGCGAATCTCGAGATTCGCCCAATGATATGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030882
VALIDATED
APOL2 MISSION shRNA Lentiviral Transduction Particles
apolipoprotein L, 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000310235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_030882.2-889s21c1
Sequence:CCGGGACCAAAGCGGCACCAATGTACTCGAGTACATTGGTGCCGCTTTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_030882.2-951s21c1
Sequence:CCGGTGTTCTTACCTTAGTTGACAACTCGAGTTGTCAACTAAGGTAAGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_030882.2-1296s21c1
Sequence:CCGGGCTCAACTTTCTCACCAAGATCTCGAGATCTTGGTGAGAAAGTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_030882.2-362s21c1
Sequence:CCGGTTGAGGATTACCTTAAGTATTCTCGAGAATACTTAAGGTAATCCTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_030882.2-833s21c1
Sequence:CCGGGCAGTGTGGTAGAACTAGTAACTCGAGTTACTAGTTCTACCACACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083103    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_030882.2-2103s1c1
Sequence:CCGGCCTTCCAAGAATAAAGTCTTTCTCGAGAAAGACTTTATTCTTGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_030882.2-951s1c1
Sequence:CCGGTGTTCTTACCTTAGTTGACAACTCGAGTTGTCAACTAAGGTAAGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_030882.2-1296s1c1
Sequence:CCGGGCTCAACTTTCTCACCAAGATCTCGAGATCTTGGTGAGAAAGTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_030882.2-833s1c1
Sequence:CCGGGCAGTGTGGTAGAACTAGTAACTCGAGTTACTAGTTCTACCACACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030882.2-1062s1c1
Sequence:CCGGCCCGCATATCATTGGGCGAATCTCGAGATTCGCCCAATGATATGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks