EMAIL THIS PAGE TO A FRIEND

APOL3

apolipoprotein L, 3

Synonyms: APOLIII CG121
UniProtKB ID: O95236, B1AHI4, B1AHI5, Q5U5N4, Q9BQ82, Q9BQA3
Gene ID:
Human(80833) Summary: This gene is a member of the apolipoprotein L gene family, and it is present in a cluster with other family members on chromosome 6. The encoded protein is found in the cytoplasm, where it may affect the movement of lipids, including cholesterol, and/or allow the binding of lipids to organelles. In addition, expression of this gene is up-regulated by tumor necrosis factor-alpha in endothelial cells lining the normal and atherosclerotic iliac artery and aorta. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2009]
Rat(315108) apolipoprotein L, 3
cow(505078) apolipoprotein L, 3
domestic cat(101091381) apolipoprotein L, 3
dog(610459) apolipoprotein L, 3
cow(512905) apolipoprotein L, 3
104 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014349 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014349 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014349 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU076211 MISSION® esiRNA esiRNA human APOL3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014349 Rosetta Predictions human pricing
NM_030644 Rosetta Predictions human pricing
NM_145639 Rosetta Predictions human pricing
NM_145640 Rosetta Predictions human pricing
NM_145641 Rosetta Predictions human pricing
NM_145642 Rosetta Predictions human pricing
NM_001013175 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014349 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00152219 predicted 1142
2 SASI_Hs01_00152220 predicted 1222
3 SASI_Hs01_00152221 predicted 1600
4 SASI_Hs01_00152222 predicted 1224
5 SASI_Hs01_00152223 predicted 1606
6 SASI_Hs01_00152224 predicted 1140
7 SASI_Hs01_00152225 predicted 1827
8 SASI_Hs01_00152226 predicted 1179
9 SASI_Hs01_00152227 predicted 1537
10 SASI_Hs01_00152228 predicted 1518
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030644 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00015947 predicted 1032
2 SASI_Hs01_00015948 predicted 1110
3 SASI_Hs01_00015949 predicted 1488
4 SASI_Hs01_00015950 predicted 1108
5 SASI_Hs01_00015951 predicted 1483
6 SASI_Hs01_00015952 predicted 1016
7 SASI_Hs01_00015953 predicted 1703
8 SASI_Hs01_00015954 predicted 1063
9 SASI_Hs01_00015955 predicted 1421
10 SASI_Hs01_00015956 predicted 1397
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145639 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00071163 predicted 910
2 SASI_Hs01_00071164 predicted 994
3 SASI_Hs01_00071165 predicted 1373
4 SASI_Hs01_00071166 predicted 990
5 SASI_Hs01_00071167 predicted 1369
6 SASI_Hs01_00071168 predicted 909
7 SASI_Hs01_00071169 predicted 1594
8 SASI_Hs01_00071170 predicted 956
9 SASI_Hs01_00071171 predicted 1301
10 SASI_Hs01_00071172 predicted 1289
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145640 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00215707 predicted 820
2 SASI_Hs01_00215708 predicted 894
3 SASI_Hs01_00215709 predicted 1274
4 SASI_Hs01_00215710 predicted 900
5 SASI_Hs01_00215711 predicted 1277
6 SASI_Hs01_00215712 predicted 812
7 SASI_Hs01_00215713 predicted 1498
8 SASI_Hs01_00215714 predicted 859
9 SASI_Hs01_00215715 predicted 1205
10 SASI_Hs01_00215716 predicted 1189
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145641 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00183845 predicted 2325
2 SASI_Hs01_00183846 predicted 2411
3 SASI_Hs01_00183847 predicted 2786
4 SASI_Hs01_00183848 predicted 2405
5 SASI_Hs01_00183849 predicted 2784
6 SASI_Hs01_00183850 predicted 2318
7 SASI_Hs01_00183851 predicted 3009
8 SASI_Hs01_00183852 predicted 2369
9 SASI_Hs01_00183853 predicted 2721
10 SASI_Hs01_00183854 predicted 2695
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145642 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00036994 predicted 2264
2 SASI_Hs01_00036995 predicted 2344
3 SASI_Hs01_00036996 predicted 2725
4 SASI_Hs01_00036997 predicted 2340
5 SASI_Hs01_00036998 predicted 2726
6 SASI_Hs01_00036999 predicted 2252
7 SASI_Hs01_00037000 predicted 2944
8 SASI_Hs01_00037001 predicted 2305
9 SASI_Hs01_00037002 predicted 2658
10 SASI_Hs01_00037003 predicted 2636
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013175 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00106791 predicted 721
2 SASI_Rn01_00106792 predicted 754
3 SASI_Rn01_00106793 predicted 704
4 SASI_Rn01_00106795 predicted 247
5 SASI_Rn01_00106796 predicted 820
6 SASI_Rn01_00106797 predicted 254
7 SASI_Rn01_00106798 predicted 683
8 SASI_Rn01_00106799 predicted 618
9 SASI_Rn01_00106800 predicted 959
10 SASI_Rn02_00200929 predicted 977
11 SASI_Rn01_00106794 predicted 911
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014349
APOL3 MISSION shRNA Bacterial Glycerol Stock
apolipoprotein L, 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000161336    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014349.2-1676s1c1
Sequence:CCGGGAGCTGAGTGTTAGTGACTTTCTCGAGAAAGTCACTAACACTCAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014349.2-1141s1c1
Sequence:CCGGCATTGACCGATTGAAGGTATTCTCGAGAATACCTTCAATCGGTCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014349.2-1426s1c1
Sequence:CCGGCAACCTTGTATACGAGTCAAACTCGAGTTTGACTCGTATACAAGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014349.2-779s1c1
Sequence:CCGGGAATATGTGCAGCAGAAAGATCTCGAGATCTTTCTGCTGCACATATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014349.2-653s1c1
Sequence:CCGGCAAATCCTGCTGACTAACAATCTCGAGATTGTTAGTCAGCAGGATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160493    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014349.2-1148s1c1
Sequence:CCGGCGATTGAAGGTATTTAAGGAACTCGAGTTCCTTAAATACCTTCAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160754    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014349.2-2003s1c1
Sequence:CCGGCGATGTCCTTCCAAGAATGAACTCGAGTTCATTCTTGGAAGGACATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161311    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014349.2-764s1c1
Sequence:CCGGGCAGCTATTGAGGACGAATATCTCGAGATATTCGTCCTCAATAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014349
APOL3 MISSION shRNA shRNA Plasmid DNA
apolipoprotein L, 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000161336    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014349.2-1676s1c1
Sequence:CCGGGAGCTGAGTGTTAGTGACTTTCTCGAGAAAGTCACTAACACTCAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014349.2-1141s1c1
Sequence:CCGGCATTGACCGATTGAAGGTATTCTCGAGAATACCTTCAATCGGTCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014349.2-1426s1c1
Sequence:CCGGCAACCTTGTATACGAGTCAAACTCGAGTTTGACTCGTATACAAGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014349.2-779s1c1
Sequence:CCGGGAATATGTGCAGCAGAAAGATCTCGAGATCTTTCTGCTGCACATATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014349.2-653s1c1
Sequence:CCGGCAAATCCTGCTGACTAACAATCTCGAGATTGTTAGTCAGCAGGATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160493    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014349.2-1148s1c1
Sequence:CCGGCGATTGAAGGTATTTAAGGAACTCGAGTTCCTTAAATACCTTCAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160754    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014349.2-2003s1c1
Sequence:CCGGCGATGTCCTTCCAAGAATGAACTCGAGTTCATTCTTGGAAGGACATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161311    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014349.2-764s1c1
Sequence:CCGGGCAGCTATTGAGGACGAATATCTCGAGATATTCGTCCTCAATAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014349
APOL3 MISSION shRNA Lentiviral Transduction Particles
apolipoprotein L, 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000161336    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014349.2-1676s1c1
Sequence:CCGGGAGCTGAGTGTTAGTGACTTTCTCGAGAAAGTCACTAACACTCAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014349.2-1141s1c1
Sequence:CCGGCATTGACCGATTGAAGGTATTCTCGAGAATACCTTCAATCGGTCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014349.2-1426s1c1
Sequence:CCGGCAACCTTGTATACGAGTCAAACTCGAGTTTGACTCGTATACAAGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014349.2-779s1c1
Sequence:CCGGGAATATGTGCAGCAGAAAGATCTCGAGATCTTTCTGCTGCACATATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014349.2-653s1c1
Sequence:CCGGCAAATCCTGCTGACTAACAATCTCGAGATTGTTAGTCAGCAGGATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160493    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014349.2-1148s1c1
Sequence:CCGGCGATTGAAGGTATTTAAGGAACTCGAGTTCCTTAAATACCTTCAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160754    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014349.2-2003s1c1
Sequence:CCGGCGATGTCCTTCCAAGAATGAACTCGAGTTCATTCTTGGAAGGACATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161311    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014349.2-764s1c1
Sequence:CCGGGCAGCTATTGAGGACGAATATCTCGAGATATTCGTCCTCAATAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks