EMAIL THIS PAGE TO A FRIEND

APOL4

apolipoprotein L, 4

36 Gene Product Result for
Synonyms: APOL-IV APOLIV
Species: Human APOL4(80832)
UniProtKB ID: Q9BPW4, Q9BQ37, Q9BXQ8
Gene ID:
Human(80832) Summary: The protein encoded by this gene is a member of the apolipoprotein L family and may play a role in lipid exchange and transport throughout the body, as well as in reverse cholesterol transport from peripheral cells to the liver. Two transcript variants encoding two different isoforms have been found for this gene. Only one of the isoforms appears to be a secreted protein. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030643 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030643 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030643 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030643 Rosetta Predictions human pricing
NM_145660 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030643 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00242418 predicted 1132
2 SASI_Hs01_00242419 predicted 1190
3 SASI_Hs01_00242420 predicted 877
4 SASI_Hs01_00242421 predicted 975
5 SASI_Hs01_00242422 predicted 789
6 SASI_Hs01_00242423 predicted 840
7 SASI_Hs01_00242424 predicted 691
8 SASI_Hs01_00242425 predicted 665
9 SASI_Hs01_00242426 predicted 1197
10 SASI_Hs01_00242427 predicted 868
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145660 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00164464 predicted 950
2 SASI_Hs01_00164465 predicted 998
3 SASI_Hs01_00164466 predicted 690
4 SASI_Hs01_00164467 predicted 791
5 SASI_Hs01_00164468 predicted 608
6 SASI_Hs01_00164469 predicted 653
7 SASI_Hs01_00164470 predicted 501
8 SASI_Hs01_00164471 predicted 482
9 SASI_Hs01_00164472 predicted 1014
10 SASI_Hs01_00164473 predicted 681
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030643
APOL4 MISSION shRNA Bacterial Glycerol Stock
apolipoprotein L, 4
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000083168    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030643.3-1614s1c1
Sequence:CCGGCGCAATCTCTAAACACAAATTCTCGAGAATTTGTGTTTAGAGATTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030643.3-1201s1c1
Sequence:CCGGGCTTGGCGATATGTACCTATACTCGAGTATAGGTACATATCGCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030643.3-1439s1c1
Sequence:CCGGCCCATATCCATCAGAGTCTAACTCGAGTTAGACTCTGATGGATATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030643.3-1191s1c1
Sequence:CCGGCCCTTTGATTGCTTGGCGATACTCGAGTATCGCCAAGCAATCAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030643.3-884s1c1
Sequence:CCGGGCGTTATGTTGGCACCATTTACTCGAGTAAATGGTGCCAACATAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030643
APOL4 MISSION shRNA shRNA Plasmid DNA
apolipoprotein L, 4
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000083168    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030643.3-1614s1c1
Sequence:CCGGCGCAATCTCTAAACACAAATTCTCGAGAATTTGTGTTTAGAGATTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030643.3-1201s1c1
Sequence:CCGGGCTTGGCGATATGTACCTATACTCGAGTATAGGTACATATCGCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030643.3-1439s1c1
Sequence:CCGGCCCATATCCATCAGAGTCTAACTCGAGTTAGACTCTGATGGATATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030643.3-1191s1c1
Sequence:CCGGCCCTTTGATTGCTTGGCGATACTCGAGTATCGCCAAGCAATCAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030643.3-884s1c1
Sequence:CCGGGCGTTATGTTGGCACCATTTACTCGAGTAAATGGTGCCAACATAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030643
APOL4 MISSION shRNA Lentiviral Transduction Particles
apolipoprotein L, 4
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000083168    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030643.3-1614s1c1
Sequence:CCGGCGCAATCTCTAAACACAAATTCTCGAGAATTTGTGTTTAGAGATTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030643.3-1201s1c1
Sequence:CCGGGCTTGGCGATATGTACCTATACTCGAGTATAGGTACATATCGCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030643.3-1439s1c1
Sequence:CCGGCCCATATCCATCAGAGTCTAACTCGAGTTAGACTCTGATGGATATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030643.3-1191s1c1
Sequence:CCGGCCCTTTGATTGCTTGGCGATACTCGAGTATCGCCAAGCAATCAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030643.3-884s1c1
Sequence:CCGGGCGTTATGTTGGCACCATTTACTCGAGTAAATGGTGCCAACATAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks