EMAIL THIS PAGE TO A FRIEND

APOL6

apolipoprotein L, 6

87 Gene Product Result for
Synonyms: APOL-VI APOLVI
UniProtKB ID: Q9BWW8, Q5R3S1, Q658J1, Q8IXX6, Q9UGG1
Gene ID:
Human(80830) Summary: This gene is a member of the apolipoprotein L gene family. The encoded protein is found in the cytoplasm, where it may affect the movement of lipids or allow the binding of lipids to organelles. [provided by RefSeq, Jul 2008]
Mouse(71939) apolipoprotein L 6
sheep(101104568) apolipoprotein L, 6
domestic guinea pig(101789141) apolipoprotein L, 6
domestic cat(101090628) apolipoprotein L, 6
cow(616957) apolipoprotein L, 6
dog(481282) apolipoprotein L, 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030641 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030641 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030641 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_001481299 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_001481299 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_001481299 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030641 Rosetta Predictions human pricing
XM_001481299 Rosetta Predictions mouse pricing
XM_484487 Rosetta Predictions mouse pricing
XM_911079 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030641 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00054622 predicted 545
2 SASI_Hs02_00358217 predicted 790
3 SASI_Hs01_00054624 predicted 880
4 SASI_Hs01_00054625 predicted 704
5 SASI_Hs01_00054626 predicted 964
6 SASI_Hs01_00054627 predicted 785
7 SASI_Hs01_00054628 predicted 324
8 SASI_Hs01_00054629 predicted 358
9 SASI_Hs01_00054631 predicted 1001
10 SASI_Hs02_00358218 predicted 459
11 SASI_Hs01_00054623 predicted 347
12 SASI_Hs01_00054630 predicted 817
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001481299 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00423514 predicted 1440
2 SASI_Mm02_00423515 predicted 1155
3 SASI_Mm02_00423516 predicted 1143
4 SASI_Mm02_00423517 predicted 1413
5 SASI_Mm02_00423518 predicted 1238
6 SASI_Mm02_00423519 predicted 1394
7 SASI_Mm02_00423520 predicted 1409
8 SASI_Mm02_00423521 predicted 1457
9 SASI_Mm02_00423522 predicted 1234
10 SASI_Mm02_00423523 predicted 1471
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_484487 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00426458 predicted 725
2 SASI_Mm02_00426459 predicted 640
3 SASI_Mm02_00426460 predicted 359
4 SASI_Mm02_00426461 predicted 577
5 SASI_Mm02_00426462 predicted 595
6 SASI_Mm02_00426463 predicted 404
7 SASI_Mm02_00426464 predicted 280
8 SASI_Mm02_00426465 predicted 686
9 SASI_Mm02_00426466 predicted 517
10 SASI_Mm02_00426467 predicted 977
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_911079 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00226077 predicted 237
2 SASI_Mm01_00226078 predicted 598
3 SASI_Mm01_00226079 predicted 601
4 SASI_Mm01_00226080 predicted 568
5 SASI_Mm01_00226081 predicted 248
6 SASI_Mm01_00226082 predicted 393
7 SASI_Mm01_00226083 predicted 602
8 SASI_Mm01_00226084 predicted 496
9 SASI_Mm01_00226085 predicted 498
10 SASI_Mm01_00226086 predicted 349
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030641
VALIDATED
APOL6 MISSION shRNA Bacterial Glycerol Stock
apolipoprotein L, 6
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000154829    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030641.2-1057s1c1
Sequence:CCGGGAATGGAAGCACCTGAAGGAACTCGAGTTCCTTCAGGTGCTTCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151208    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030641.2-423s1c1
Sequence:CCGGGAGAGAATTTCCCAGATTGAACTCGAGTTCAATCTGGGAAATTCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153001    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_030641.2-1425s1c1
Sequence:CCGGGCCTTCTGTTTCTCCTTCAATCTCGAGATTGAAGGAGAAACAGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154011    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030641.2-822s1c1
Sequence:CCGGCACCTTGAAGTATGCCAAGAACTCGAGTTCTTGGCATACTTCAAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153359    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_030641.2-1354s1c1
Sequence:CCGGGCCTTGGAGGTCCAAATAATACTCGAGTATTATTTGGACCTCCAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_030641.2-510s1c1
Sequence:CCGGGAAATTCACCAAGGCTAACATCTCGAGATGTTAGCCTTGGTGAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_030641.2-445s1c1
Sequence:CCGGGAAGATCTGAAAGGGAACATTCTCGAGAATGTTCCCTTTCAGATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150793    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_030641.2-2631s1c1
Sequence:CCGGGCTCACTGAGATAGATACATACTCGAGTATGTATCTATCTCAGTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000441488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030641.3-378s21c1
Sequence:CCGGGGAGCTACAAGACGGAGATCTCTCGAGAGATCTCCGTCTTGTAGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000441343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030641.3-886s21c1
Sequence:CCGGGCCAATGCTACCAAGCGTCTTCTCGAGAAGACGCTTGGTAGCATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030641.3-1235s21c1
Sequence:CCGGAGGCTTACTGGAAGGAGTTAACTCGAGTTAACTCCTTCCAGTAAGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030641
VALIDATED
APOL6 MISSION shRNA shRNA Plasmid DNA
apolipoprotein L, 6
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000154829    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030641.2-1057s1c1
Sequence:CCGGGAATGGAAGCACCTGAAGGAACTCGAGTTCCTTCAGGTGCTTCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151208    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030641.2-423s1c1
Sequence:CCGGGAGAGAATTTCCCAGATTGAACTCGAGTTCAATCTGGGAAATTCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153001    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_030641.2-1425s1c1
Sequence:CCGGGCCTTCTGTTTCTCCTTCAATCTCGAGATTGAAGGAGAAACAGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154011    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030641.2-822s1c1
Sequence:CCGGCACCTTGAAGTATGCCAAGAACTCGAGTTCTTGGCATACTTCAAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153359    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_030641.2-1354s1c1
Sequence:CCGGGCCTTGGAGGTCCAAATAATACTCGAGTATTATTTGGACCTCCAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_030641.2-510s1c1
Sequence:CCGGGAAATTCACCAAGGCTAACATCTCGAGATGTTAGCCTTGGTGAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_030641.2-445s1c1
Sequence:CCGGGAAGATCTGAAAGGGAACATTCTCGAGAATGTTCCCTTTCAGATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150793    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_030641.2-2631s1c1
Sequence:CCGGGCTCACTGAGATAGATACATACTCGAGTATGTATCTATCTCAGTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000441488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030641.3-378s21c1
Sequence:CCGGGGAGCTACAAGACGGAGATCTCTCGAGAGATCTCCGTCTTGTAGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000441343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030641.3-886s21c1
Sequence:CCGGGCCAATGCTACCAAGCGTCTTCTCGAGAAGACGCTTGGTAGCATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030641.3-1235s21c1
Sequence:CCGGAGGCTTACTGGAAGGAGTTAACTCGAGTTAACTCCTTCCAGTAAGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030641
VALIDATED
APOL6 MISSION shRNA Lentiviral Transduction Particles
apolipoprotein L, 6
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000154829    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030641.2-1057s1c1
Sequence:CCGGGAATGGAAGCACCTGAAGGAACTCGAGTTCCTTCAGGTGCTTCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151208    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030641.2-423s1c1
Sequence:CCGGGAGAGAATTTCCCAGATTGAACTCGAGTTCAATCTGGGAAATTCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153001    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_030641.2-1425s1c1
Sequence:CCGGGCCTTCTGTTTCTCCTTCAATCTCGAGATTGAAGGAGAAACAGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154011    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030641.2-822s1c1
Sequence:CCGGCACCTTGAAGTATGCCAAGAACTCGAGTTCTTGGCATACTTCAAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153359    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_030641.2-1354s1c1
Sequence:CCGGGCCTTGGAGGTCCAAATAATACTCGAGTATTATTTGGACCTCCAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_030641.2-510s1c1
Sequence:CCGGGAAATTCACCAAGGCTAACATCTCGAGATGTTAGCCTTGGTGAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_030641.2-445s1c1
Sequence:CCGGGAAGATCTGAAAGGGAACATTCTCGAGAATGTTCCCTTTCAGATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150793    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_030641.2-2631s1c1
Sequence:CCGGGCTCACTGAGATAGATACATACTCGAGTATGTATCTATCTCAGTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000441488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030641.3-378s21c1
Sequence:CCGGGGAGCTACAAGACGGAGATCTCTCGAGAGATCTCCGTCTTGTAGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000441343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030641.3-886s21c1
Sequence:CCGGGCCAATGCTACCAAGCGTCTTCTCGAGAAGACGCTTGGTAGCATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030641.3-1235s21c1
Sequence:CCGGAGGCTTACTGGAAGGAGTTAACTCGAGTTAACTCCTTCCAGTAAGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_001481299
APOL6 MISSION shRNA Bacterial Glycerol Stock
apolipoprotein L, 6
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000239585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001481299.1-885s21c1
Sequence:CCGGTGGGAACGCCTGGGATAATATCTCGAGATATTATCCCAGGCGTTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001481299.1-1094s21c1
Sequence:CCGGCCCTTGGCCAGGACATATATACTCGAGTATATATGTCCTGGCCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001481299.1-89s21c1
Sequence:CCGGCACCTGACTGGGCACTAATTGCTCGAGCAATTAGTGCCCAGTCAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001481299.1-527s21c1
Sequence:CCGGAGCGCATTAGAACGCTCTATGCTCGAGCATAGAGCGTTCTAATGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239581    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_001481299.1-1413s21c1
Sequence:CCGGGTAGAGCCATGTCGATGTTATCTCGAGATAACATCGACATGGCTCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_001481299
APOL6 MISSION shRNA shRNA Plasmid DNA
apolipoprotein L, 6
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000239585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001481299.1-885s21c1
Sequence:CCGGTGGGAACGCCTGGGATAATATCTCGAGATATTATCCCAGGCGTTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001481299.1-1094s21c1
Sequence:CCGGCCCTTGGCCAGGACATATATACTCGAGTATATATGTCCTGGCCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001481299.1-89s21c1
Sequence:CCGGCACCTGACTGGGCACTAATTGCTCGAGCAATTAGTGCCCAGTCAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001481299.1-527s21c1
Sequence:CCGGAGCGCATTAGAACGCTCTATGCTCGAGCATAGAGCGTTCTAATGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239581    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_001481299.1-1413s21c1
Sequence:CCGGGTAGAGCCATGTCGATGTTATCTCGAGATAACATCGACATGGCTCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_001481299
APOL6 MISSION shRNA Lentiviral Transduction Particles
apolipoprotein L, 6
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000239585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001481299.1-885s21c1
Sequence:CCGGTGGGAACGCCTGGGATAATATCTCGAGATATTATCCCAGGCGTTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001481299.1-1094s21c1
Sequence:CCGGCCCTTGGCCAGGACATATATACTCGAGTATATATGTCCTGGCCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001481299.1-89s21c1
Sequence:CCGGCACCTGACTGGGCACTAATTGCTCGAGCAATTAGTGCCCAGTCAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001481299.1-527s21c1
Sequence:CCGGAGCGCATTAGAACGCTCTATGCTCGAGCATAGAGCGTTCTAATGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239581    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_001481299.1-1413s21c1
Sequence:CCGGGTAGAGCCATGTCGATGTTATCTCGAGATAACATCGACATGGCTCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks