EMAIL THIS PAGE TO A FRIEND

APOLD1

apolipoprotein L domain containing 1

122 Gene Product Result for
Synonyms: VERGE
UniProtKB ID: Q96LR9, Q8IVR2, Q9H0I5
Gene ID:
Human(81575) Summary: APOLD1 is an endothelial cell early response protein that may play a role in regulation of endothelial cell signaling and vascular function (Regard et al., 2004 [PubMed 15102925]
Mouse(381823) apolipoprotein L domain containing 1
Rat(444983) apolipoprotein L domain containing 1
naked mole-rat(101704324) apolipoprotein L domain containing 1
domestic guinea pig(100712744) apolipoprotein L domain containing 1
sheep(101111443) apolipoprotein L domain containing 1
chicken(769889) apolipoprotein L domain containing 1
domestic cat(101092694) apolipoprotein L domain containing 1
cow(538827) apolipoprotein L domain containing 1
dog(611186) apolipoprotein L domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030817 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030817 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030817 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001109914 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001109914 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001109914 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU096821 MISSION® esiRNA esiRNA human APOLD1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030817 Rosetta Predictions human pricing
NM_001003403 Rosetta Predictions rat pricing
NM_001109914 Rosetta Predictions mouse pricing
XM_355823 Rosetta Predictions mouse pricing
XM_905672 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030817 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00129776 predicted 560
2 SASI_Hs02_00358396 predicted 1205
3 SASI_Hs01_00129778 predicted 915
4 SASI_Hs01_00129781 predicted 554
5 SASI_Hs02_00358397 predicted 1255
6 SASI_Hs01_00129785 predicted 560
7 SASI_Hs02_00358398 predicted 865
8 SASI_Hs02_00358399 predicted 1011
9 SASI_Hs02_00358400 predicted 395
10 SASI_Hs02_00358401 predicted 748
11 SASI_Hs01_00129777 predicted 1231
12 SASI_Hs01_00129779 predicted 1184
13 SASI_Hs01_00129780 predicted 1261
14 SASI_Hs01_00129782 predicted 797
15 SASI_Hs01_00129783 predicted 932
16 SASI_Hs01_00129784 predicted 582
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003403 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00050863 predicted 1072
2 SASI_Rn01_00050864 predicted 1069
3 SASI_Rn01_00050865 predicted 903
4 SASI_Rn01_00050867 predicted 916
5 SASI_Rn01_00050868 predicted 1071
6 SASI_Rn01_00050869 predicted 1093
7 SASI_Rn01_00050870 predicted 1016
8 SASI_Rn02_00198037 predicted 1102
9 SASI_Rn01_00050871 predicted 1195
10 SASI_Rn01_00050872 predicted 1189
11 SASI_Rn01_00050866 predicted 1249
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109914 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00304444 predicted 917
2 SASI_Mm02_00304445 predicted 1031
3 SASI_Mm02_00304446 predicted 798
4 SASI_Mm02_00304447 predicted 1225
5 SASI_Mm02_00304448 predicted 522
6 SASI_Mm02_00304449 predicted 1225
7 SASI_Mm02_00304450 predicted 786
8 SASI_Mm02_00304451 predicted 849
9 SASI_Mm02_00304452 predicted 833
10 SASI_Mm02_00304453 predicted 1015
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_355823 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00217245 predicted 514
2 SASI_Mm01_00217246 predicted 507
3 SASI_Mm01_00217247 predicted 804
4 SASI_Mm01_00217248 predicted 521
5 SASI_Mm01_00217249 predicted 812
6 SASI_Mm01_00217250 predicted 775
7 SASI_Mm01_00217251 predicted 790
8 SASI_Mm01_00217252 predicted 850
9 SASI_Mm01_00217253 predicted 844
10 SASI_Mm01_00217254 predicted 769
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_905672 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00431970 predicted 910
2 SASI_Mm02_00431971 predicted 1032
3 SASI_Mm02_00431972 predicted 504
4 SASI_Mm02_00431973 predicted 800
5 SASI_Mm02_00431974 predicted 1232
6 SASI_Mm02_00431975 predicted 514
7 SASI_Mm02_00431976 predicted 1218
8 SASI_Mm02_00431977 predicted 840
9 SASI_Mm02_00431978 predicted 792
10 SASI_Mm02_00431979 predicted 1013
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030817
APOLD1 MISSION shRNA Bacterial Glycerol Stock
apolipoprotein L domain containing 1
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000005615    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030817.1-1495s1c1
Sequence:CCGGCCGACATCATTGTGTTCAGAACTCGAGTTCTGAACACAATGATGTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030817.1-392s1c1
Sequence:CCGGCCAGGACCAGATGCGAGAGATCTCGAGATCTCTCGCATCTGGTCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030817.1-594s1c1
Sequence:CCGGCTGAAGGCCAAGATTCAGAAACTCGAGTTTCTGAATCTTGGCCTTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030817.1-494s1c1
Sequence:CCGGCGCCCTGTACAATTCTGTCTACTCGAGTAGACAGAATTGTACAGGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030817.1-309s1c1
Sequence:CCGGGCCGTCACCATCACGTCCGATCTCGAGATCGGACGTGATGGTGACGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422275    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030817.2-876s21c1
Sequence:CCGGCATGGGATGCTCCAGAATTTGCTCGAGCAAATTCTGGAGCATCCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030817
APOLD1 MISSION shRNA shRNA Plasmid DNA
apolipoprotein L domain containing 1
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000005615    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030817.1-1495s1c1
Sequence:CCGGCCGACATCATTGTGTTCAGAACTCGAGTTCTGAACACAATGATGTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030817.1-392s1c1
Sequence:CCGGCCAGGACCAGATGCGAGAGATCTCGAGATCTCTCGCATCTGGTCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030817.1-594s1c1
Sequence:CCGGCTGAAGGCCAAGATTCAGAAACTCGAGTTTCTGAATCTTGGCCTTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030817.1-494s1c1
Sequence:CCGGCGCCCTGTACAATTCTGTCTACTCGAGTAGACAGAATTGTACAGGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030817.1-309s1c1
Sequence:CCGGGCCGTCACCATCACGTCCGATCTCGAGATCGGACGTGATGGTGACGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422275    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030817.2-876s21c1
Sequence:CCGGCATGGGATGCTCCAGAATTTGCTCGAGCAAATTCTGGAGCATCCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030817
APOLD1 MISSION shRNA Lentiviral Transduction Particles
apolipoprotein L domain containing 1
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000005615    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030817.1-1495s1c1
Sequence:CCGGCCGACATCATTGTGTTCAGAACTCGAGTTCTGAACACAATGATGTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030817.1-392s1c1
Sequence:CCGGCCAGGACCAGATGCGAGAGATCTCGAGATCTCTCGCATCTGGTCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030817.1-594s1c1
Sequence:CCGGCTGAAGGCCAAGATTCAGAAACTCGAGTTTCTGAATCTTGGCCTTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030817.1-494s1c1
Sequence:CCGGCGCCCTGTACAATTCTGTCTACTCGAGTAGACAGAATTGTACAGGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030817.1-309s1c1
Sequence:CCGGGCCGTCACCATCACGTCCGATCTCGAGATCGGACGTGATGGTGACGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422275    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030817.2-876s21c1
Sequence:CCGGCATGGGATGCTCCAGAATTTGCTCGAGCAAATTCTGGAGCATCCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001109914
APOLD1 MISSION shRNA Bacterial Glycerol Stock
apolipoprotein L domain containing 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000252570    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001109914.1-2409s21c1
Sequence:CCGGTAAACTGTAGTTGGCGTATATCTCGAGATATACGCCAACTACAGTTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001109914.1-773s21c1
Sequence:CCGGAGAGCATCCTCTACCTATATGCTCGAGCATATAGGTAGAGGATGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001109914.1-523s21c1
Sequence:CCGGCTGTCTACTTCATCGTCTTCTCTCGAGAGAAGACGATGAAGTAGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001109914.1-347s21c1
Sequence:CCGGCTCTCTGATCTTCTGCAATTCCTCGAGGAATTGCAGAAGATCAGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001109914.1-747s21c1
Sequence:CCGGGATCTGGACGCAGCGTTGTTTCTCGAGAAACAACGCTGCGTCCAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001109914
APOLD1 MISSION shRNA shRNA Plasmid DNA
apolipoprotein L domain containing 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000252570    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001109914.1-2409s21c1
Sequence:CCGGTAAACTGTAGTTGGCGTATATCTCGAGATATACGCCAACTACAGTTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001109914.1-773s21c1
Sequence:CCGGAGAGCATCCTCTACCTATATGCTCGAGCATATAGGTAGAGGATGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001109914.1-523s21c1
Sequence:CCGGCTGTCTACTTCATCGTCTTCTCTCGAGAGAAGACGATGAAGTAGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001109914.1-347s21c1
Sequence:CCGGCTCTCTGATCTTCTGCAATTCCTCGAGGAATTGCAGAAGATCAGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001109914.1-747s21c1
Sequence:CCGGGATCTGGACGCAGCGTTGTTTCTCGAGAAACAACGCTGCGTCCAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001109914
APOLD1 MISSION shRNA Lentiviral Transduction Particles
apolipoprotein L domain containing 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000252570    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001109914.1-2409s21c1
Sequence:CCGGTAAACTGTAGTTGGCGTATATCTCGAGATATACGCCAACTACAGTTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001109914.1-773s21c1
Sequence:CCGGAGAGCATCCTCTACCTATATGCTCGAGCATATAGGTAGAGGATGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001109914.1-523s21c1
Sequence:CCGGCTGTCTACTTCATCGTCTTCTCTCGAGAGAAGACGATGAAGTAGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001109914.1-347s21c1
Sequence:CCGGCTCTCTGATCTTCTGCAATTCCTCGAGGAATTGCAGAAGATCAGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001109914.1-747s21c1
Sequence:CCGGGATCTGGACGCAGCGTTGTTTCTCGAGAAACAACGCTGCGTCCAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks