EMAIL THIS PAGE TO A FRIEND

APOM

apolipoprotein M

56 Gene Product Result for
Synonyms: G3a HSPC336 NG20 apo-M
UniProtKB ID: O95445, B0UX98, Q5SRP4, Q9P046, Q9UMP6
Gene ID:
Human(55937) Summary: The protein encoded by this gene is an apolipoprotein and member of the lipocalin protein family. It is found associated with high density lipoproteins and to a lesser extent with low density lipoproteins and triglyceride-rich lipoproteins. The encoded protein is secreted through the plasma membrane but remains membrane-bound, where it is involved in lipid transport. Alternate splicing results in both coding and non-coding variants of this gene. [provided by RefSeq, Jan 2012]
Mouse(55938) apolipoprotein M
Rat(55939) apolipoprotein M
Zebrafish(569714) apolipoprotein M
dog(474843) apolipoprotein M
cow(505830) apolipoprotein M
domestic cat(101086722) apolipoprotein M
sheep(101121210) apolipoprotein M
naked mole-rat(101709948) apolipoprotein M
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0467 AQUA Peptide AFLLTP[R] human pricing
AQ0468 AQUA Peptide DGL(CM-Cys)VP[R] human, mouse pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019101 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019101 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019101 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_018816 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_018816 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_018816 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_019101 Rosetta Predictions human pricing
NM_019373 Rosetta Predictions rat pricing
NM_018816 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019101 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00029518 predicted 261
2 SASI_Hs01_00029519 predicted 236
3 SASI_Hs01_00029521 predicted 388
4 SASI_Hs01_00029523 predicted 381
5 SASI_Hs02_00352720 predicted 390
6 SASI_Hs01_00029525 predicted 407
7 SASI_Hs01_00029526 predicted 444
8 SASI_Hs02_00352721 predicted 333
9 SASI_Hs02_00352722 predicted 365
10 SASI_Hs02_00352723 predicted 323
11 SASI_Hs01_00029520 predicted 489
12 SASI_Hs01_00029522 predicted 462
13 SASI_Hs01_00029524 predicted 521
14 SASI_Hs01_00029527 predicted 267
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019373 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00070480 predicted 301
2 SASI_Rn01_00070481 predicted 358
3 SASI_Rn01_00070482 predicted 484
4 SASI_Rn01_00070483 predicted 343
5 SASI_Rn01_00070484 predicted 419
6 SASI_Rn01_00070485 predicted 395
7 SASI_Rn01_00070486 predicted 242
8 SASI_Rn01_00070488 predicted 215
9 SASI_Rn01_00070489 predicted 378
10 SASI_Rn02_00262398 predicted 345
11 SASI_Rn01_00070487 predicted 217
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018816 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00133821 predicted 451
2 SASI_Mm01_00133822 predicted 447
3 SASI_Mm01_00133823 predicted 282
4 SASI_Mm01_00133824 predicted 217
5 SASI_Mm01_00133825 predicted 418
6 SASI_Mm01_00133826 predicted 317
7 SASI_Mm01_00133827 predicted 328
8 SASI_Mm01_00133828 predicted 369
9 SASI_Mm01_00133829 predicted 446
10 SASI_Mm01_00133830 predicted 323
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019101
APOM MISSION shRNA Bacterial Glycerol Stock
apolipoprotein M
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000371396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019101.2-498s21c1
Sequence:CCGGAGCGCTTTCTCCTCTACAATCCTCGAGGATTGTAGAGGAGAAAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019101.2-577s21c1
Sequence:CCGGGGACTCCAAAGCCTTCTTATTCTCGAGAATAAGAAGGCTTTGGAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019101.2-326s1c1
Sequence:CCGGCGTGCTACCATCCGCATGAAACTCGAGTTTCATGCGGATGGTAGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019101.2-270s1c1
Sequence:CCGGTGGACAACATTGTCTTCAATACTCGAGTATTGAAGACAATGTTGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019101.2-100s1c1
Sequence:CCGGGCTCTACTTCTATGGTATTATCTCGAGATAATACCATAGAAGTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019101.2-458s1c1
Sequence:CCGGCCAGGTGGAATCATGCTGAATCTCGAGATTCAGCATGATTCCACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019101.2-202s1c1
Sequence:CCGGCTTGGGCCAGTGGTACTTTATCTCGAGATAAAGTACCACTGGCCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019101
APOM MISSION shRNA shRNA Plasmid DNA
apolipoprotein M
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000371396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019101.2-498s21c1
Sequence:CCGGAGCGCTTTCTCCTCTACAATCCTCGAGGATTGTAGAGGAGAAAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019101.2-577s21c1
Sequence:CCGGGGACTCCAAAGCCTTCTTATTCTCGAGAATAAGAAGGCTTTGGAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019101.2-326s1c1
Sequence:CCGGCGTGCTACCATCCGCATGAAACTCGAGTTTCATGCGGATGGTAGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019101.2-270s1c1
Sequence:CCGGTGGACAACATTGTCTTCAATACTCGAGTATTGAAGACAATGTTGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019101.2-100s1c1
Sequence:CCGGGCTCTACTTCTATGGTATTATCTCGAGATAATACCATAGAAGTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019101.2-458s1c1
Sequence:CCGGCCAGGTGGAATCATGCTGAATCTCGAGATTCAGCATGATTCCACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019101.2-202s1c1
Sequence:CCGGCTTGGGCCAGTGGTACTTTATCTCGAGATAAAGTACCACTGGCCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019101
APOM MISSION shRNA Lentiviral Transduction Particles
apolipoprotein M
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000371396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019101.2-498s21c1
Sequence:CCGGAGCGCTTTCTCCTCTACAATCCTCGAGGATTGTAGAGGAGAAAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019101.2-577s21c1
Sequence:CCGGGGACTCCAAAGCCTTCTTATTCTCGAGAATAAGAAGGCTTTGGAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019101.2-326s1c1
Sequence:CCGGCGTGCTACCATCCGCATGAAACTCGAGTTTCATGCGGATGGTAGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019101.2-270s1c1
Sequence:CCGGTGGACAACATTGTCTTCAATACTCGAGTATTGAAGACAATGTTGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019101.2-100s1c1
Sequence:CCGGGCTCTACTTCTATGGTATTATCTCGAGATAATACCATAGAAGTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019101.2-458s1c1
Sequence:CCGGCCAGGTGGAATCATGCTGAATCTCGAGATTCAGCATGATTCCACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019101.2-202s1c1
Sequence:CCGGCTTGGGCCAGTGGTACTTTATCTCGAGATAAAGTACCACTGGCCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018816
APOM MISSION shRNA Bacterial Glycerol Stock
apolipoprotein M
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000105040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018816.1-420s1c1
Sequence:CCGGCCAGGAGGAATCATGCTGAAACTCGAGTTTCAGCATGATTCCTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018816.1-320s1c1
Sequence:CCGGCCGGAAGTGGACATACCGATTCTCGAGAATCGGTATGTCCACTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018816.1-110s1c1
Sequence:CCGGTCAACTAACTGCGCTGGGAATCTCGAGATTCCCAGCGCAGTTAGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018816.1-197s1c1
Sequence:CCGGCACGGAAGAGTTGGCAACTTTCTCGAGAAAGTTGCCAACTCTTCCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018816.1-282s1c1
Sequence:CCGGCGTGCTACCATCCGCACGAAACTCGAGTTTCGTGCGGATGGTAGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018816
APOM MISSION shRNA shRNA Plasmid DNA
apolipoprotein M
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000105040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018816.1-420s1c1
Sequence:CCGGCCAGGAGGAATCATGCTGAAACTCGAGTTTCAGCATGATTCCTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018816.1-320s1c1
Sequence:CCGGCCGGAAGTGGACATACCGATTCTCGAGAATCGGTATGTCCACTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018816.1-110s1c1
Sequence:CCGGTCAACTAACTGCGCTGGGAATCTCGAGATTCCCAGCGCAGTTAGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018816.1-197s1c1
Sequence:CCGGCACGGAAGAGTTGGCAACTTTCTCGAGAAAGTTGCCAACTCTTCCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018816.1-282s1c1
Sequence:CCGGCGTGCTACCATCCGCACGAAACTCGAGTTTCGTGCGGATGGTAGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018816
APOM MISSION shRNA Lentiviral Transduction Particles
apolipoprotein M
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000105040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018816.1-420s1c1
Sequence:CCGGCCAGGAGGAATCATGCTGAAACTCGAGTTTCAGCATGATTCCTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018816.1-320s1c1
Sequence:CCGGCCGGAAGTGGACATACCGATTCTCGAGAATCGGTATGTCCACTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018816.1-110s1c1
Sequence:CCGGTCAACTAACTGCGCTGGGAATCTCGAGATTCCCAGCGCAGTTAGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018816.1-197s1c1
Sequence:CCGGCACGGAAGAGTTGGCAACTTTCTCGAGAAAGTTGCCAACTCTTCCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018816.1-282s1c1
Sequence:CCGGCGTGCTACCATCCGCACGAAACTCGAGTTTCGTGCGGATGGTAGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks