EMAIL THIS PAGE TO A FRIEND

APOO

apolipoprotein O

68 Gene Product Result for
Synonyms: FAM121B
UniProtKB ID: Q9BUR5, B2R4K9, Q9H3J9
Gene ID:
Human(79135) Summary: This gene is a member of the apolipoprotein family. Members of this protein family are involved in the transport and metabolism of lipids. The encoded protein associates with HDL, LDL and VLDL lipoproteins and is characterized by chondroitin-sulfate glycosylation. This protein may be involved in preventing lipid accumulation in the myocardium in obese and diabetic patients. Alternative splicing results in multiple transcript variants. Pseudogenes of this gene are found on chromosomes 3, 4, 5, 12 and 16.[provided by RefSeq, Sep 2009]
Mouse(68316) apolipoprotein O
Rat(363474) apolipoprotein O
chicken(418599) apolipoprotein O
cow(513847) apolipoprotein O
domestic cat(101094158) apolipoprotein O
naked mole-rat(101696400) apolipoprotein O
sheep(101113910) apolipoprotein O
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024122 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024122 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024122 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026673 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026673 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026673 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU136051 MISSION® esiRNA esiRNA human APOO (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024122 Rosetta Predictions human pricing
XM_343793 Rosetta Predictions rat pricing
NM_026673 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024122 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00085764 predicted 728
2 SASI_Hs01_00085765 predicted 821
3 SASI_Hs02_00356612 predicted 405
4 SASI_Hs01_00085768 predicted 857
5 SASI_Hs01_00085769 predicted 273
6 SASI_Hs02_00356613 predicted 379
7 SASI_Hs02_00356614 predicted 319
8 SASI_Hs02_00356615 predicted 828
9 SASI_Hs01_00085766 predicted 618
10 SASI_Hs01_00085770 predicted 658
11 SASI_Hs01_00085763 predicted 582
12 SASI_Hs01_00085767 predicted 855
13 SASI_Hs01_00085771 predicted 659
14 SASI_Hs01_00085772 predicted 834
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_343793 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00396339 predicted 635
2 SASI_Rn02_00396340 predicted 853
3 SASI_Rn02_00396341 predicted 560
4 SASI_Rn02_00396342 predicted 628
5 SASI_Rn02_00396343 predicted 789
6 SASI_Rn02_00396344 predicted 572
7 SASI_Rn02_00396345 predicted 791
8 SASI_Rn02_00396346 predicted 903
9 SASI_Rn02_00396347 predicted 948
10 SASI_Rn02_00396348 predicted 890
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026673 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00031863 predicted 335
2 SASI_Mm01_00031864 predicted 479
3 SASI_Mm01_00031865 predicted 237
4 SASI_Mm02_00330694 predicted 668
5 SASI_Mm01_00031866 predicted 444
6 SASI_Mm02_00330695 predicted 327
7 SASI_Mm01_00031867 predicted 652
8 SASI_Mm01_00031869 predicted 269
9 SASI_Mm01_00031870 predicted 642
10 SASI_Mm01_00031871 predicted 248
11 SASI_Mm01_00031868 predicted 470
12 SASI_Mm01_00031872 predicted 445
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024122
VALIDATED
APOO MISSION shRNA Bacterial Glycerol Stock
apolipoprotein O
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000072703    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_024122.2-963s1c1
Sequence:CCGGCCTCTGTTATCTTCTGTGAAACTCGAGTTTCACAGAAGATAACAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_024122.2-636s1c1
Sequence:CCGGCCTGGTTTCATGGGATTAGCTCTCGAGAGCTAATCCCATGAAACCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_024122.2-732s1c1
Sequence:CCGGCGAGGATATATAGTCATAGAACTCGAGTTCTATGACTATATATCCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024122.2-477s1c1
Sequence:CCGGCCCAAGATGCAAAGTTTGGTTCTCGAGAACCAAACTTTGCATCTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_024122.2-657s1c1
Sequence:CCGGGCCTCCCTCTATTATCCACAACTCGAGTTGTGGATAATAGAGGGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024122
VALIDATED
APOO MISSION shRNA shRNA Plasmid DNA
apolipoprotein O
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000072703    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_024122.2-963s1c1
Sequence:CCGGCCTCTGTTATCTTCTGTGAAACTCGAGTTTCACAGAAGATAACAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_024122.2-636s1c1
Sequence:CCGGCCTGGTTTCATGGGATTAGCTCTCGAGAGCTAATCCCATGAAACCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_024122.2-732s1c1
Sequence:CCGGCGAGGATATATAGTCATAGAACTCGAGTTCTATGACTATATATCCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024122.2-477s1c1
Sequence:CCGGCCCAAGATGCAAAGTTTGGTTCTCGAGAACCAAACTTTGCATCTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_024122.2-657s1c1
Sequence:CCGGGCCTCCCTCTATTATCCACAACTCGAGTTGTGGATAATAGAGGGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024122
VALIDATED
APOO MISSION shRNA Lentiviral Transduction Particles
apolipoprotein O
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000072703    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_024122.2-963s1c1
Sequence:CCGGCCTCTGTTATCTTCTGTGAAACTCGAGTTTCACAGAAGATAACAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_024122.2-636s1c1
Sequence:CCGGCCTGGTTTCATGGGATTAGCTCTCGAGAGCTAATCCCATGAAACCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_024122.2-732s1c1
Sequence:CCGGCGAGGATATATAGTCATAGAACTCGAGTTCTATGACTATATATCCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024122.2-477s1c1
Sequence:CCGGCCCAAGATGCAAAGTTTGGTTCTCGAGAACCAAACTTTGCATCTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_024122.2-657s1c1
Sequence:CCGGGCCTCCCTCTATTATCCACAACTCGAGTTGTGGATAATAGAGGGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026673
VALIDATED
APOO MISSION shRNA Bacterial Glycerol Stock
apolipoprotein O
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000238031    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026673.3-655s21c1
Sequence:CCGGCTGCCCATTTCAATCAGTTATCTCGAGATAACTGATTGAAATGGGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238030    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026673.3-248s21c1
Sequence:CCGGACATCATTGTGAGCCATATACCTCGAGGTATATGGCTCACAATGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026673.3-555s21c1
Sequence:CCGGTTACGAGGGTACATAGTTATACTCGAGTATAACTATGTACCCTCGTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026673.3-477s21c1
Sequence:CCGGTTAGGTGCCTCTGTCTATTACCTCGAGGTAATAGACAGAGGCACCTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026673.3-374s21c1
Sequence:CCGGTTTCCCAAGACTCGGTGTTATCTCGAGATAACACCGAGTCTTGGGAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026673
VALIDATED
APOO MISSION shRNA shRNA Plasmid DNA
apolipoprotein O
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000238031    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026673.3-655s21c1
Sequence:CCGGCTGCCCATTTCAATCAGTTATCTCGAGATAACTGATTGAAATGGGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238030    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026673.3-248s21c1
Sequence:CCGGACATCATTGTGAGCCATATACCTCGAGGTATATGGCTCACAATGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026673.3-555s21c1
Sequence:CCGGTTACGAGGGTACATAGTTATACTCGAGTATAACTATGTACCCTCGTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026673.3-477s21c1
Sequence:CCGGTTAGGTGCCTCTGTCTATTACCTCGAGGTAATAGACAGAGGCACCTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026673.3-374s21c1
Sequence:CCGGTTTCCCAAGACTCGGTGTTATCTCGAGATAACACCGAGTCTTGGGAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026673
VALIDATED
APOO MISSION shRNA Lentiviral Transduction Particles
apolipoprotein O
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000238031    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026673.3-655s21c1
Sequence:CCGGCTGCCCATTTCAATCAGTTATCTCGAGATAACTGATTGAAATGGGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238030    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026673.3-248s21c1
Sequence:CCGGACATCATTGTGAGCCATATACCTCGAGGTATATGGCTCACAATGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026673.3-555s21c1
Sequence:CCGGTTACGAGGGTACATAGTTATACTCGAGTATAACTATGTACCCTCGTAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026673.3-477s21c1
Sequence:CCGGTTAGGTGCCTCTGTCTATTACCTCGAGGTAATAGACAGAGGCACCTAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026673.3-374s21c1
Sequence:CCGGTTTCCCAAGACTCGGTGTTATCTCGAGATAACACCGAGTCTTGGGAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)