EMAIL THIS PAGE TO A FRIEND

APOOL

apolipoprotein O-like

102 Gene Product Result for
Synonyms: CXorf33 FAM121A UNQ8193
UniProtKB ID: Q6UXV4, Q3KNU7, Q5H9D1
Gene ID:
Human(139322) Summary: This gene encodes a protein which contains an apolipoprotein O superfamily domain. This domain is found on proteins in circulating lipoprotein complexes. [provided by RefSeq, Sep 2011]
Mouse(68117) apolipoprotein O-like
Rat(317191) apolipoprotein O-like
chicken(422271) apolipoprotein O-like
dog(608758) apolipoprotein O-like
domestic cat(101098040) apolipoprotein O-like
cow(506138) apolipoprotein O-like
naked mole-rat(101701262) apolipoprotein O-like
domestic guinea pig(100720881) apolipoprotein O-like
sheep(101123352) apolipoprotein O-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198450 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198450 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198450 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026565 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026565 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026565 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198450 Rosetta Predictions human pricing
NM_001014105 Rosetta Predictions rat pricing
NM_026565 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198450 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00051048 predicted 536
2 SASI_Hs01_00051050 predicted 482
3 SASI_Hs01_00051051 predicted 646
4 SASI_Hs01_00051053 predicted 275
5 SASI_Hs02_00371958 predicted 482
6 SASI_Hs02_00371959 predicted 855
7 SASI_Hs02_00371960 predicted 472
8 SASI_Hs02_00371961 predicted 781
9 SASI_Hs02_00371962 predicted 811
10 SASI_Hs02_00371963 predicted 273
11 SASI_Hs01_00051049 predicted 664
12 SASI_Hs01_00051052 predicted 475
13 SASI_Hs01_00051054 predicted 472
14 SASI_Hs01_00051055 predicted 209
15 SASI_Hs01_00051056 predicted 376
16 SASI_Hs01_00051057 predicted 255
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014105 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00050246 predicted 640
2 SASI_Rn01_00050247 predicted 596
3 SASI_Rn01_00050248 predicted 707
4 SASI_Rn01_00050249 predicted 341
5 SASI_Rn01_00050250 predicted 567
6 SASI_Rn01_00050252 predicted 739
7 SASI_Rn02_00201543 predicted 589
8 SASI_Rn01_00050253 predicted 342
9 SASI_Rn02_00201544 predicted 501
10 SASI_Rn01_00050254 predicted 281
11 SASI_Rn01_00050251 predicted 533
12 SASI_Rn01_00050255 predicted 501
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026565 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00143022 predicted 216
2 SASI_Mm01_00143023 predicted 708
3 SASI_Mm01_00143024 predicted 243
4 SASI_Mm01_00143025 predicted 474
5 SASI_Mm01_00143026 predicted 710
6 SASI_Mm01_00143027 predicted 573
7 SASI_Mm01_00143028 predicted 272
8 SASI_Mm01_00143029 predicted 576
9 SASI_Mm01_00143030 predicted 443
10 SASI_Mm01_00143031 predicted 243
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198450
APOOL MISSION shRNA Bacterial Glycerol Stock
apolipoprotein O-like
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000371397    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198450.3-904s21c1
Sequence:CCGGGTAACTGATACATAGAGTATTCTCGAGAATACTCTATGTATCAGTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198450.3-283s21c1
Sequence:CCGGTAATGGATACAGTACAATTTGCTCGAGCAAATTGTACTGTATCCATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198450.3-616s21c1
Sequence:CCGGTAGGATCCTCTTCCGAAATAGCTCGAGCTATTTCGGAAGAGGATCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198450.1-697s1c1
Sequence:CCGGGCTCTGAAGCAAAGACCAAATCTCGAGATTTGGTCTTTGCTTCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198450.1-785s1c1
Sequence:CCGGCCCAGAAGATATAGATATGTACTCGAGTACATATCTATATCTTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198450.1-574s1c1
Sequence:CCGGGCAAAGAAGAGTCACTCCCTACTCGAGTAGGGAGTGACTCTTCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198450.1-470s1c1
Sequence:CCGGCTACCCAGTTCAGTCCGTAATCTCGAGATTACGGACTGAACTGGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198450.1-684s1c1
Sequence:CCGGCCAACAGAACTCAGCTCTGAACTCGAGTTCAGAGCTGAGTTCTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198450
APOOL MISSION shRNA shRNA Plasmid DNA
apolipoprotein O-like
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000371397    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198450.3-904s21c1
Sequence:CCGGGTAACTGATACATAGAGTATTCTCGAGAATACTCTATGTATCAGTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198450.3-283s21c1
Sequence:CCGGTAATGGATACAGTACAATTTGCTCGAGCAAATTGTACTGTATCCATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198450.3-616s21c1
Sequence:CCGGTAGGATCCTCTTCCGAAATAGCTCGAGCTATTTCGGAAGAGGATCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198450.1-697s1c1
Sequence:CCGGGCTCTGAAGCAAAGACCAAATCTCGAGATTTGGTCTTTGCTTCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198450.1-785s1c1
Sequence:CCGGCCCAGAAGATATAGATATGTACTCGAGTACATATCTATATCTTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198450.1-574s1c1
Sequence:CCGGGCAAAGAAGAGTCACTCCCTACTCGAGTAGGGAGTGACTCTTCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198450.1-470s1c1
Sequence:CCGGCTACCCAGTTCAGTCCGTAATCTCGAGATTACGGACTGAACTGGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198450.1-684s1c1
Sequence:CCGGCCAACAGAACTCAGCTCTGAACTCGAGTTCAGAGCTGAGTTCTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198450
APOOL MISSION shRNA Lentiviral Transduction Particles
apolipoprotein O-like
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000371397    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198450.3-904s21c1
Sequence:CCGGGTAACTGATACATAGAGTATTCTCGAGAATACTCTATGTATCAGTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198450.3-283s21c1
Sequence:CCGGTAATGGATACAGTACAATTTGCTCGAGCAAATTGTACTGTATCCATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198450.3-616s21c1
Sequence:CCGGTAGGATCCTCTTCCGAAATAGCTCGAGCTATTTCGGAAGAGGATCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198450.1-697s1c1
Sequence:CCGGGCTCTGAAGCAAAGACCAAATCTCGAGATTTGGTCTTTGCTTCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198450.1-785s1c1
Sequence:CCGGCCCAGAAGATATAGATATGTACTCGAGTACATATCTATATCTTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198450.1-574s1c1
Sequence:CCGGGCAAAGAAGAGTCACTCCCTACTCGAGTAGGGAGTGACTCTTCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198450.1-470s1c1
Sequence:CCGGCTACCCAGTTCAGTCCGTAATCTCGAGATTACGGACTGAACTGGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198450.1-684s1c1
Sequence:CCGGCCAACAGAACTCAGCTCTGAACTCGAGTTCAGAGCTGAGTTCTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026565
VALIDATED
APOOL MISSION shRNA Bacterial Glycerol Stock
apolipoprotein O-like
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000277074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026565.2-218s21c1
Sequence:CCGGCCGTACTACAACCGTGTATTACTCGAGTAATACACGGTTGTAGTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277073    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026565.2-839s21c1
Sequence:CCGGGAGAACTGCAAGATGTACCAACTCGAGTTGGTACATCTTGCAGTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026565.2-326s21c1
Sequence:CCGGGAAGAATCCTCCGCAAGATTTCTCGAGAAATCTTGCGGAGGATTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026565.2-653s21c1
Sequence:CCGGCCTGAAACATTCAGTGTCTTTCTCGAGAAAGACACTGAATGTTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026565.2-176s21c1
Sequence:CCGGTGAAGAACAGCCTGGTAATTTCTCGAGAAATTACCAGGCTGTTCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026565.2-69s1c1
Sequence:CCGGGCATCTATAAATGTGCGTCTTCTCGAGAAGACGCACATTTATAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190793    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026565.2-839s1c1
Sequence:CCGGGAGAACTGCAAGATGTACCAACTCGAGTTGGTACATCTTGCAGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026565.2-218s1c1
Sequence:CCGGCCGTACTACAACCGTGTATTACTCGAGTAATACACGGTTGTAGTACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192758    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026565.2-653s1c1
Sequence:CCGGCCTGAAACATTCAGTGTCTTTCTCGAGAAAGACACTGAATGTTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026565
VALIDATED
APOOL MISSION shRNA shRNA Plasmid DNA
apolipoprotein O-like
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000277074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026565.2-218s21c1
Sequence:CCGGCCGTACTACAACCGTGTATTACTCGAGTAATACACGGTTGTAGTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277073    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026565.2-839s21c1
Sequence:CCGGGAGAACTGCAAGATGTACCAACTCGAGTTGGTACATCTTGCAGTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026565.2-326s21c1
Sequence:CCGGGAAGAATCCTCCGCAAGATTTCTCGAGAAATCTTGCGGAGGATTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026565.2-653s21c1
Sequence:CCGGCCTGAAACATTCAGTGTCTTTCTCGAGAAAGACACTGAATGTTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026565.2-176s21c1
Sequence:CCGGTGAAGAACAGCCTGGTAATTTCTCGAGAAATTACCAGGCTGTTCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026565.2-69s1c1
Sequence:CCGGGCATCTATAAATGTGCGTCTTCTCGAGAAGACGCACATTTATAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190793    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026565.2-839s1c1
Sequence:CCGGGAGAACTGCAAGATGTACCAACTCGAGTTGGTACATCTTGCAGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026565.2-218s1c1
Sequence:CCGGCCGTACTACAACCGTGTATTACTCGAGTAATACACGGTTGTAGTACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192758    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026565.2-653s1c1
Sequence:CCGGCCTGAAACATTCAGTGTCTTTCTCGAGAAAGACACTGAATGTTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026565
VALIDATED
APOOL MISSION shRNA Lentiviral Transduction Particles
apolipoprotein O-like
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000277074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026565.2-218s21c1
Sequence:CCGGCCGTACTACAACCGTGTATTACTCGAGTAATACACGGTTGTAGTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277073    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026565.2-839s21c1
Sequence:CCGGGAGAACTGCAAGATGTACCAACTCGAGTTGGTACATCTTGCAGTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026565.2-326s21c1
Sequence:CCGGGAAGAATCCTCCGCAAGATTTCTCGAGAAATCTTGCGGAGGATTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026565.2-653s21c1
Sequence:CCGGCCTGAAACATTCAGTGTCTTTCTCGAGAAAGACACTGAATGTTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026565.2-176s21c1
Sequence:CCGGTGAAGAACAGCCTGGTAATTTCTCGAGAAATTACCAGGCTGTTCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026565.2-69s1c1
Sequence:CCGGGCATCTATAAATGTGCGTCTTCTCGAGAAGACGCACATTTATAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190793    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026565.2-839s1c1
Sequence:CCGGGAGAACTGCAAGATGTACCAACTCGAGTTGGTACATCTTGCAGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026565.2-218s1c1
Sequence:CCGGCCGTACTACAACCGTGTATTACTCGAGTAATACACGGTTGTAGTACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192758    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026565.2-653s1c1
Sequence:CCGGCCTGAAACATTCAGTGTCTTTCTCGAGAAAGACACTGAATGTTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks