EMAIL THIS PAGE TO A FRIEND

APOPT1

apoptogenic 1, mitochondrial

50 Gene Product Result for
Synonyms: APOP1 C14orf153
UniProtKB ID: Q96IL0, Q53G28
Gene ID:
Mouse(68020) apoptogenic, mitochondrial 1
Rat(299341) apoptogenic 1, mitochondrial
Zebrafish(798687) apoptogenic 1, mitochondrial
domestic cat(101085898) apoptogenic 1, mitochondrial
cow(617441) apoptogenic 1, mitochondrial
dog(100687117) apoptogenic 1, mitochondrial
chicken(423483) apoptogenic 1
sheep(101102428) apoptogenic 1, mitochondrial
domestic guinea pig(100722780) apoptogenic 1, mitochondrial
naked mole-rat(101710003) apoptogenic 1, mitochondrial
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026511 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026511 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026511 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032374 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032374 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032374 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032374 Rosetta Predictions human pricing
NM_001037769 Rosetta Predictions rat pricing
NM_026511 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032374 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00035085 predicted 543
2 SASI_Hs01_00035086 predicted 424
3 SASI_Hs01_00035087 predicted 275
4 SASI_Hs01_00035089 predicted 454
5 SASI_Hs01_00035090 predicted 537
6 SASI_Hs01_00035092 predicted 482
7 SASI_Hs02_00359760 predicted 293
8 SASI_Hs01_00035093 predicted 299
9 SASI_Hs02_00359761 predicted 411
10 SASI_Hs02_00359762 predicted 390
11 SASI_Hs01_00035088 predicted 614
12 SASI_Hs01_00035091 predicted 472
13 SASI_Hs01_00035094 predicted 474
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037769 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00072266 predicted 414
2 SASI_Rn02_00204556 predicted 336
3 SASI_Rn02_00204557 predicted 448
4 SASI_Rn01_00072267 predicted 399
5 SASI_Rn01_00072268 predicted 334
6 SASI_Rn01_00072269 predicted 560
7 SASI_Rn01_00072270 predicted 453
8 SASI_Rn01_00072271 predicted 477
9 SASI_Rn01_00072273 predicted 334
10 SASI_Rn01_00072274 predicted 474
11 SASI_Rn01_00072272 predicted 422
12 SASI_Rn01_00072275 predicted 244
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026511 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00199311 predicted 498
2 SASI_Mm01_00199312 predicted 500
3 SASI_Mm01_00199313 predicted 432
4 SASI_Mm01_00199314 predicted 491
5 SASI_Mm01_00199315 predicted 760
6 SASI_Mm01_00199316 predicted 452
7 SASI_Mm01_00199317 predicted 209
8 SASI_Mm01_00199318 predicted 735
9 SASI_Mm01_00199319 predicted 260
10 SASI_Mm01_00199320 predicted 286
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026511
VALIDATED
APOPT1 MISSION shRNA Bacterial Glycerol Stock
apoptogenic 1, mitochondrial
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201919    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026511.1-500s1c1
Sequence:CCGGCGAGACTGGTACAAGCGTAATCTCGAGATTACGCTTGTACCAGTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026511.1-272s1c1
Sequence:CCGGCTTAGAGAATTGAGACAAGAACTCGAGTTCTTGTCTCAATTCTCTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191619    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026511.1-784s1c1
Sequence:CCGGGCTCAGAATATTGCAGTGTAACTCGAGTTACACTGCAATATTCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191731    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026511.1-809s1c1
Sequence:CCGGGTGAATAAAGTTTCACTGCAACTCGAGTTGCAGTGAAACTTTATTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192456    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026511.1-200s1c1
Sequence:CCGGCCAGACAAATGCTCAAACCTTCTCGAGAAGGTTTGAGCATTTGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200752    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026511.1-290s1c1
Sequence:CCGGGAAACGCAAGAATGGAATCAACTCGAGTTGATTCCATTCTTGCGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026511.1-376s21c1
Sequence:CCGGACAAGCTAAGGGCGCAGGCTTCTCGAGAAGCCTGCGCCCTTAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279156    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026511.1-784s21c1
Sequence:CCGGGCTCAGAATATTGCAGTGTAACTCGAGTTACACTGCAATATTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026511.1-272s21c1
Sequence:CCGGCTTAGAGAATTGAGACAAGAACTCGAGTTCTTGTCTCAATTCTCTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026511.1-140s21c1
Sequence:CCGGTCCAGCCGGGTCTCAAGATTCCTCGAGGAATCTTGAGACCCGGCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026511.1-200s21c1
Sequence:CCGGCCAGACAAATGCTCAAACCTTCTCGAGAAGGTTTGAGCATTTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026511
VALIDATED
APOPT1 MISSION shRNA shRNA Plasmid DNA
apoptogenic 1, mitochondrial
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201919    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026511.1-500s1c1
Sequence:CCGGCGAGACTGGTACAAGCGTAATCTCGAGATTACGCTTGTACCAGTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026511.1-272s1c1
Sequence:CCGGCTTAGAGAATTGAGACAAGAACTCGAGTTCTTGTCTCAATTCTCTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191619    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026511.1-784s1c1
Sequence:CCGGGCTCAGAATATTGCAGTGTAACTCGAGTTACACTGCAATATTCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191731    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026511.1-809s1c1
Sequence:CCGGGTGAATAAAGTTTCACTGCAACTCGAGTTGCAGTGAAACTTTATTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192456    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026511.1-200s1c1
Sequence:CCGGCCAGACAAATGCTCAAACCTTCTCGAGAAGGTTTGAGCATTTGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200752    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026511.1-290s1c1
Sequence:CCGGGAAACGCAAGAATGGAATCAACTCGAGTTGATTCCATTCTTGCGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026511.1-376s21c1
Sequence:CCGGACAAGCTAAGGGCGCAGGCTTCTCGAGAAGCCTGCGCCCTTAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279156    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026511.1-784s21c1
Sequence:CCGGGCTCAGAATATTGCAGTGTAACTCGAGTTACACTGCAATATTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026511.1-272s21c1
Sequence:CCGGCTTAGAGAATTGAGACAAGAACTCGAGTTCTTGTCTCAATTCTCTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026511.1-140s21c1
Sequence:CCGGTCCAGCCGGGTCTCAAGATTCCTCGAGGAATCTTGAGACCCGGCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026511.1-200s21c1
Sequence:CCGGCCAGACAAATGCTCAAACCTTCTCGAGAAGGTTTGAGCATTTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026511
VALIDATED
APOPT1 MISSION shRNA Lentiviral Transduction Particles
apoptogenic 1, mitochondrial
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201919    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026511.1-500s1c1
Sequence:CCGGCGAGACTGGTACAAGCGTAATCTCGAGATTACGCTTGTACCAGTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026511.1-272s1c1
Sequence:CCGGCTTAGAGAATTGAGACAAGAACTCGAGTTCTTGTCTCAATTCTCTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191619    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026511.1-784s1c1
Sequence:CCGGGCTCAGAATATTGCAGTGTAACTCGAGTTACACTGCAATATTCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191731    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026511.1-809s1c1
Sequence:CCGGGTGAATAAAGTTTCACTGCAACTCGAGTTGCAGTGAAACTTTATTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192456    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026511.1-200s1c1
Sequence:CCGGCCAGACAAATGCTCAAACCTTCTCGAGAAGGTTTGAGCATTTGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200752    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026511.1-290s1c1
Sequence:CCGGGAAACGCAAGAATGGAATCAACTCGAGTTGATTCCATTCTTGCGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026511.1-376s21c1
Sequence:CCGGACAAGCTAAGGGCGCAGGCTTCTCGAGAAGCCTGCGCCCTTAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279156    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026511.1-784s21c1
Sequence:CCGGGCTCAGAATATTGCAGTGTAACTCGAGTTACACTGCAATATTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026511.1-272s21c1
Sequence:CCGGCTTAGAGAATTGAGACAAGAACTCGAGTTCTTGTCTCAATTCTCTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026511.1-140s21c1
Sequence:CCGGTCCAGCCGGGTCTCAAGATTCCTCGAGGAATCTTGAGACCCGGCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026511.1-200s21c1
Sequence:CCGGCCAGACAAATGCTCAAACCTTCTCGAGAAGGTTTGAGCATTTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032374
VALIDATED
APOPT1 MISSION shRNA Bacterial Glycerol Stock
apoptogenic 1, mitochondrial
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000167894    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032374.2-150s1c1
Sequence:CCGGCCAAGAAAGTCTTGCCATGATCTCGAGATCATGGCAAGACTTTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166911    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032374.2-398s1c1
Sequence:CCGGGAAAGCAACATTGAATGCAGACTCGAGTCTGCATTCAATGTTGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167141    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032374.2-182s1c1
Sequence:CCGGCCCAGATAAATATTCAAACCTCTCGAGAGGTTTGAATATTTATCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032374.2-136s1c1
Sequence:CCGGCAAGATTCTGCCCTCCAAGAACTCGAGTTCTTGGAGGGCAGAATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032374.3-614s21c1
Sequence:CCGGAGCAACTAGGAGTCCACTCTGCTCGAGCAGAGTGGACTCCTAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032374.3-491s21c1
Sequence:CCGGTTTCAGAAGCACATGTATTATCTCGAGATAATACATGTGCTTCTGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365158    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032374.3-868s21c1
Sequence:CCGGCGTTTCCTGTGTTTCGAATTACTCGAGTAATTCGAAACACAGGAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032374.3-517s21c1
Sequence:CCGGAGATTGGTACAAGCGCAATTTCTCGAGAAATTGCGCTTGTACCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032374.3-575s21c1
Sequence:CCGGAGGATTTGGAACAAGCTTAAACTCGAGTTTAAGCTTGTTCCAAATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032374.3-264s21c1
Sequence:CCGGATGAATCTCCATTGGAACAAACTCGAGTTTGTTCCAATGGAGATTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370276    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032374.3-826s21c1
Sequence:CCGGGTCACGTACGTGGTGTGAAATCTCGAGATTTCACACCACGTACGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032374
VALIDATED
APOPT1 MISSION shRNA shRNA Plasmid DNA
apoptogenic 1, mitochondrial
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000167894    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032374.2-150s1c1
Sequence:CCGGCCAAGAAAGTCTTGCCATGATCTCGAGATCATGGCAAGACTTTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166911    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032374.2-398s1c1
Sequence:CCGGGAAAGCAACATTGAATGCAGACTCGAGTCTGCATTCAATGTTGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167141    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032374.2-182s1c1
Sequence:CCGGCCCAGATAAATATTCAAACCTCTCGAGAGGTTTGAATATTTATCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032374.2-136s1c1
Sequence:CCGGCAAGATTCTGCCCTCCAAGAACTCGAGTTCTTGGAGGGCAGAATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032374.3-614s21c1
Sequence:CCGGAGCAACTAGGAGTCCACTCTGCTCGAGCAGAGTGGACTCCTAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032374.3-491s21c1
Sequence:CCGGTTTCAGAAGCACATGTATTATCTCGAGATAATACATGTGCTTCTGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365158    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032374.3-868s21c1
Sequence:CCGGCGTTTCCTGTGTTTCGAATTACTCGAGTAATTCGAAACACAGGAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032374.3-517s21c1
Sequence:CCGGAGATTGGTACAAGCGCAATTTCTCGAGAAATTGCGCTTGTACCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032374.3-575s21c1
Sequence:CCGGAGGATTTGGAACAAGCTTAAACTCGAGTTTAAGCTTGTTCCAAATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032374.3-264s21c1
Sequence:CCGGATGAATCTCCATTGGAACAAACTCGAGTTTGTTCCAATGGAGATTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370276    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032374.3-826s21c1
Sequence:CCGGGTCACGTACGTGGTGTGAAATCTCGAGATTTCACACCACGTACGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032374
VALIDATED
APOPT1 MISSION shRNA Lentiviral Transduction Particles
apoptogenic 1, mitochondrial
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000167894    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032374.2-150s1c1
Sequence:CCGGCCAAGAAAGTCTTGCCATGATCTCGAGATCATGGCAAGACTTTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166911    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032374.2-398s1c1
Sequence:CCGGGAAAGCAACATTGAATGCAGACTCGAGTCTGCATTCAATGTTGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167141    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032374.2-182s1c1
Sequence:CCGGCCCAGATAAATATTCAAACCTCTCGAGAGGTTTGAATATTTATCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032374.2-136s1c1
Sequence:CCGGCAAGATTCTGCCCTCCAAGAACTCGAGTTCTTGGAGGGCAGAATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032374.3-614s21c1
Sequence:CCGGAGCAACTAGGAGTCCACTCTGCTCGAGCAGAGTGGACTCCTAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032374.3-491s21c1
Sequence:CCGGTTTCAGAAGCACATGTATTATCTCGAGATAATACATGTGCTTCTGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365158    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032374.3-868s21c1
Sequence:CCGGCGTTTCCTGTGTTTCGAATTACTCGAGTAATTCGAAACACAGGAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032374.3-517s21c1
Sequence:CCGGAGATTGGTACAAGCGCAATTTCTCGAGAAATTGCGCTTGTACCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032374.3-575s21c1
Sequence:CCGGAGGATTTGGAACAAGCTTAAACTCGAGTTTAAGCTTGTTCCAAATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032374.3-264s21c1
Sequence:CCGGATGAATCTCCATTGGAACAAACTCGAGTTTGTTCCAATGGAGATTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370276    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032374.3-826s21c1
Sequence:CCGGGTCACGTACGTGGTGTGAAATCTCGAGATTTCACACCACGTACGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks