EMAIL THIS PAGE TO A FRIEND

APP

amyloid beta (A4) precursor protein

310 Gene Product Result for
Synonyms: AAA ABETA ABPP AD1 APPI CTFgamma CVAP PN-II PN2
Gene ID:
Human(351) Summary: This gene encodes a cell surface receptor and transmembrane precursor protein that is cleaved by secretases to form a number of peptides. Some of these peptides are secreted and can bind to the acetyltransferase complex APBB1/TIP60 to promote transcriptional activation, while others form the protein basis of the amyloid plaques found in the brains of patients with Alzheimer disease. Mutations in this gene have been implicated in autosomal dominant Alzheimer disease and cerebroarterial amyloidosis (cerebral amyloid angiopathy). Multiple transcript variants encoding several different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(11820) amyloid beta (A4) precursor protein
Rat(54226) amyloid beta (A4) precursor protein
fruit fly(39399) approximated
chicken(374198) amyloid beta (A4) precursor protein
domestic cat(101085564) amyloid beta (A4) precursor protein
cow(280722) amyloid beta (A4) precursor protein
dog(403407) amyloid beta (A4) precursor protein
naked mole-rat(101724743) amyloid beta (A4) precursor protein
domestic guinea pig(100715302) amyloid beta (A4) precursor protein
sheep(101111593) amyloid beta (A4) precursor protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
A1976 Anti-Amyloid Peptide β, Cleavage Site 42 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution rat, mouse, human
dot blot, ELISA, immunohistochemistry, immunoprecipitation, radioimmunoassay, western blot pricing
A8717 Anti-Amyloid Precursor Protein, C-Terminal antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution rat, mouse, human
immunohistochemistry, microarray, western blot pricing
A8842 Anti-Amyloid Precursor Protein, KPI Domain antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse, human, rat
immunohistochemistry, microarray pricing
A8967 Anti-Amyloid Precursor Protein, N-Terminal antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution rat, mouse, human
immunohistochemistry, microarray, western blot pricing
SAB4300464 Anti-APP (Ab-668) antibody produced in rabbit affinity isolated antibody rat, mouse, human
immunofluorescence, western blot pricing
SAB2100134 Anti-APP (ab1) antibody produced in rabbit affinity isolated antibody canine, guinea pig, zebrafish, rabbit, mouse, human, bovine, rat, horse, pig
western blot pricing
SAB2100135 Anti-APP (ab2) antibody produced in rabbit affinity isolated antibody guinea pig, canine, horse, zebrafish, bovine, rabbit, pig, mouse, human, rat
western blot pricing
SAB2100136 Anti-APP (ab3) antibody produced in rabbit IgG fraction of antiserum mouse, rabbit, guinea pig, human, bovine, rat, rabbit, rat, pig, horse, canine
western blot pricing
SAB4200536 Anti-APP (N-terminal region) antibody produced in rabbit IgG fraction of antiserum mouse, rat, human
immunofluorescence, western blot pricing
SAB2501664 Anti-App (N-terminal) antibody produced in goat affinity isolated antibody, buffered aqueous solution rat, mouse
ELISA, western blot pricing
SAB2502012 Anti-APP (N-terminal) antibody produced in goat affinity isolated antibody, buffered aqueous solution bovine, pig, human, canine
ELISA, western blot pricing
HPA001462 Anti-APP antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB4200535 Anti-APP antibody produced in rabbit ~1.0 mg/mL, affinity isolated antibody human
immunofluorescence, immunoprecipitation pricing
SAB3500274 Anti-APP antibody produced in rabbit affinity isolated antibody, buffered aqueous solution rat, human, mouse
ELISA, immunohistochemistry, western blot pricing
SAB2107345 Anti-APP antibody produced in rabbit affinity isolated antibody rabbit, guinea pig, horse, mouse, human
ELISA, western blot pricing
SAB2106270 Anti-APP antibody produced in rabbit affinity isolated antibody mouse, human
ELISA, western blot pricing
SAB1306067 ANTI-APP-Y756 antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
A8978 Anti-β-Amyloid (13-28) antibody, Mouse monoclonal clone BAM90.1, purified from hybridoma cell culture human
enzyme immunoassay, immunohistochemistry, immunoprecipitation, western blot pricing
A3356 Anti-β-Amyloid (22-35) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution rat, human, mouse
ELISA, western blot pricing
A8326 Anti-β-Amyloid Protein (1-40) antibody produced in rabbit whole antiserum human
dot blot, immunohistochemistry pricing
SAB4503755 Anti-phospho-Amyloid β A4 (pThr743/668) antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4301223 Anti-phospho-Amyloid β A4 (pThr743/668) antibody produced in rabbit affinity isolated antibody human, mouse, rat
immunohistochemistry, western blot pricing
SAB4300153 Anti-phospho-APP (p668) antibody produced in rabbit affinity isolated antibody rat, mouse, human
western blot pricing
A9103 Anti-phospho-APP (pThr668) antibody produced in rabbit affinity isolated antibody, aqueous glycerol solution, 10 blots human
western blot pricing
WH0000351M1 Monoclonal Anti-APP antibody produced in mouse clone 2C12, purified immunoglobulin, buffered aqueous solution human
ELISA, proximity ligation assay, western blot pricing
SAB4100478 Monoclonal Anti-APP antibody produced in mouse clone APP-A434, culture supernatant human
western blot pricing
SAB4100500 Monoclonal Anti-APP antibody produced in mouse clone APP-B434, culture supernatant human
western blot pricing
SAB1403560 Monoclonal Anti-APP, (C-terminal) antibody produced in mouse clone 1E6, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
A8354 Monoclonal Anti-β-Amyloid antibody produced in mouse clone NAB 228, purified from hybridoma cell culture human
ELISA, immunohistochemistry, immunoprecipitation, microarray, western blot pricing
A3981 Monoclonal Anti-β-Amyloid antibody produced in mouse clone BAM-10, purified from hybridoma cell culture human
ELISA, immunohistochemistry, western blot pricing
A5213 Monoclonal Anti-β-Amyloid antibody produced in mouse clone BAM-10, ascites fluid human
ELISA, immunohistochemistry pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
E8375 Eserine human, mouse, rat pricing
45710 Eserine ≥98.0% (N) human, mouse, rat pricing

Proteins

Product # Description Species Add to Cart
 
A1222 7-Methoxycoumarin-4-acetyl-[Asn670, Leu671]-Amyloid β/A4 Precursor Protein 770 Fragment 667-674-(2,4-dinitrophenol)Dap ≥97% (HPLC) human pricing
A1472 7-Methoxycoumarin-4-acetyl-[Asn670, Leu671]-Amyloid β/A4 Precursor Protein 770 Fragment 667-676-(2,4-dinitrophenyl)Lys-Arg-Arg amide ≥90% (HPLC) human pricing
A1597 7-Methoxycoumarin-4-acetyl-[Asn670, Leu671]-Amyloid β/A4 Precursor Protein 770 Fragment 669-674-(2,4-dinitrophenyl)Lys trifluoroacetate salt ≥96% (HPLC) human pricing
SCP0002 Acetyl-Amyloid β 25-35 ≥97% (HPLC) human pricing
A6933 Acetyl-Amyloid β-Protein Fragment 15-20 Amide ≥97% (HPLC), powder human pricing
SCP0041 [Ala28]-Amyloid β 25-35 ≥95% (HPLC) human pricing
A0189 Amyloid β Protein Fragment 1-38 ≥95% (HPLC), powder human pricing
A1075 Amyloid β Protein Fragment 1-40 ≥90% (HPLC), powder human pricing
A9810 Amyloid β Protein Fragment 1-42 human pricing
A4473 Amyloid β-Protein Fragment 1-40 amide trifluoroacetate salt ≥95% (HPLC), lyophilized powder human pricing
A7712 Amyloid β-Protein Fragment 1-43 human pricing
A4723 Amyloid β-Protein Fragment 17-28 ≥90% (HPLC), lyophilized powder human pricing
A4848 Amyloid β-Protein Fragment 17-40 ≥87% (HPLC), lyophilized powder human pricing
A5080 Amyloid β-Protein Fragment 22-35 ≥95% (HPLC) human pricing
A4559 Amyloid β-Protein Fragment 25-35 ≥97% (HPLC) human pricing
A2201 Amyloid β-Protein Fragment 35-25 ≥95% (HPLC) human pricing
A2326 Amyloid β-Protein Fragment 40-1 ≥90% (HPLC) human pricing
A3347 Amyloid BRI Protein Precursor 227 Fragment 89-106 ≥81% (HPLC), solid human pricing
S8065 Amyloid Precursor Protein α (304-612), Secreted human >90% (SDS-PAGE), recombinant, expressed in E. coli (N-terminal histidine tagged), buffered aqueous solution human pricing
S9564 Amyloid Precursor Protein α, Secreted human >90% (SDS-PAGE), recombinant, expressed in E. coli (N-terminal histidine tagged), buffered aqueous solution human pricing
S4316 Amyloid Precursor Protein β, Secreted human ≥85% (SDS-PAGE), recombinant, expressed in E. coli (N-terminal histidine tagged), solution, sterile; 0.2 μm filtered human pricing
A1473 Amyloid Precursor Protein N-Terminal Peptide lyophilized powder human pricing
A7973 [Arg13] Amyloid-β-Protein Fragment 1-40 ≥80% (HPLC), lyophilized powder human pricing
A1097 [Asn(4-aminobutyl)1,7,23,Gln(4-aminobutyl)3,11,22]-Amyloid β-Protein 1-40 ≥90% (HPLC) human pricing
A1972 [Asn670, Leu671]-Amyloid β/A4 Precursor Protein 770 Fragment 667-676 trifluoroacetate salt ≥95% (HPLC), solid human pricing
A4972 DABCYL-[Asn670, Leu671]-Amyloid β/A4 Precursor Protein 770 fragment 661-675−EDANS trifluoroacetate salt ≥97% (HPLC), solid human pricing
A5097 DABCYL-[Asn670, Leu671]-Amyloid β/A4 Precursor Protein 770 Fragment 669-674-EDANS ammonium salt ≥95% (HPLC), solid human pricing
SCP0031 [Glu11]-Amyloid β 10-16 human ≥95% (HPLC) human pricing
SCP0029 [Gly22]-Amyloid β 1-40 Arctic human ≥95% (HPLC) human pricing
SCP0030 [Gly22]-Amyloid β 1-42 Arctic human ≥98% (HPLC) human pricing
A4348 [Nle35]-Amyloid β-Protein Fragment 1-40 ≥90% (HPLC), lyophilized powder human pricing
A2597 [pGlu3]-Amyloid β-Protein Fragment 3-42 ≥90% (HPLC), solid human pricing
A4223 [Phe10]-Amyloid β-Protein Fragment 1-40 ≥95% (HPLC), lyophilized powder human pricing
APREST77493 PrEST Antigen APP Prestige Antigens Powered by Atlas Antibodies, buffered aqueous solution human pricing
QPREST22650 SILuPrEST A4 SILuPrESTs Powered by Atlas Antibodies, buffered aqueous solution human pricing
A2722 [Val671]-Amyloid β/A4 Precursor Protein 770 Fragment 667-676 trifluoroacetate salt ≥95% (HPLC), solid human pricing
A5973 Amyloid-β-Protein Fragment 1-40, All D-Amino Acids >70% (HPLC), lyophilized powder human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000484 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000484 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000484 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007471 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007471 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007471 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Related Products

Product # Description Species Add to Cart
 
AG918 β Amyloid 1-40, aβ, F4W, TFA, recombinant human pricing
AG962 β Amyloid 1-40, aβ, ultra pure, HFIP, recombinant human pricing
AG964 β Amyloid 1-40, aβ, ultra pure, NaOH, recombinant human pricing
AG910 β Amyloid 1-40, aβ, ultra pure, TFA, recombinant human pricing
AG916 β Amyloid 1-42, aβ, scrambled, TFA, recombinant E. coli pricing
AG972 β Amyloid 1-42, aβ, ultra pure, HCl, recombinant human pricing
AG968 β Amyloid 1-42, aβ, ultra pure, HFIP, recombinant human pricing
AG970 β Amyloid 1-42, aβ, ultra pure, NaOH, recombinant human pricing
AG912 β Amyloid 1-42, aβ, ultra pure, TFA, recombinant human pricing
AG542 β amyloid 1-42, rat and mouse pricing
AG974 β Amyloid 1-43, aβ, ultra pure, TFA, recombinant human pricing
AG546 β amyloid 11-40, rat and mouse pricing
ABN1650 Anti-Aβ-42 Antibody, oligomeric (VIA) Anti-Aβ-42, oligomeric (VIA), Cat. No. ABN1650, is a highly specific rabbit polyclonal antibody that targets oligomeric amyloid beta 42 and has been tested in Dot Blot, Immunofluorescence, Immunohistochemistry, and Western Blotting. pricing
ABN1665 Anti-Aβ-42 Antibody, oligomeric (VIA) Anti-Aβ-42, oligomeric (VIA), Cat. No. ABN1665, is a highly specific rabbit polyclonal antibody that targets Amyloid beta 42 oligomers and has been tested in Dot Blot, Neutralizing, and Western Blotting. pricing
MAB348A4 Anti-Alzheimer Precursor Protein A4 Antibody, clone 22C11, Alexa488 Conj. Anti-Alzheimer Precursor Protein A4 Antibody, clone 22C11, Alexa488 Conj. is an antibody against Alzheimer Precursor Protein A4 for use in IHC, ICC. pricing
MAB348B Anti-Alzheimer Precursor Protein A4 Antibody, clone 22C11, Biotin Conj. | MAB348B pricing
FCMAB327F Anti-Alzheimer Precursor Protein A4 (NT)-FITC Antibody, clone 22C11 Anti-Alzheimer Precursor Protein A4 (N-terminus)-FITC Antibody, clone 22C11 detects level of Alzheimer Precursor Protein A4 (N-terminus) & has been published & validated for use in FC. pricing
ABN240 Anti-Amyloid, β 1-40, aβ Antibody Anti-Amyloid, β 1-40, aβ Antibody is an antibody against Amyloid, β 1-40, aβ for use in Western Blotting, IHC(P), ELISA. pricing
MABN11 Anti-Amyloid β40 Antibody, clone G2-10 Detect Amyloid β40 using this Anti-Amyloid β40 Antibody, clone G2-10 validated for use in WB, IH, ELISA. pricing
MABN12 Anti-Amyloid β42 Antibody, clone G2-11 Anti-Amyloid β42 Antibody, clone G2-11 detects level of Amyloid β42 & has been published & validated for use in WB, WB, ELISA, IH. pricing
MABN13 Anti-Amyloid β42 Antibody, clone G2-13 Anti-Amyloid β42 Antibody, clone G2-13 is an antibody against Amyloid β42 for use in WB, IH, ELISA. pricing
05-799 Anti-Amyloid β (Aβ)x-40 Antibody, clone 11A5-B10 Detect Amyloid β (Aβ)x-40 using this Anti-Amyloid β (Aβ)x-40 Antibody, clone 11A5-B10 validated for use in WB, IH. pricing
MABN639 Anti-Amyloid βA4, clone 1E8 (Amino Terminus) Antibody This Anti-Amyloid βA4, clone 1E8 (Amino Terminus) Antibody is validated for use in western blotting, IHC & IP for the detection of Amyloid βA4. pricing
MAB5208-100UG Anti-Amyloid Antibody, β 1-16, clone AB10 Anti-Amyloid Antibody, β 1-16, clone AB10 detects level of Amyloid & has been published & validated for use in ELISA, IP, WB, IC, IH. pricing
MAB5208 Anti-Amyloid Antibody, β 1-16, clone AB10 Anti-Amyloid Antibody, β 1-16, clone AB10 detects level of Amyloid & has been published & validated for use in ELISA, IP, WB, IC, IH. pricing
MAB5206 Anti-Amyloid Antibody, β 1-16, clone DE2 Anti-Amyloid Antibody, β 1-16, clone DE2 is an antibody against Amyloid for use in ELISA, WB, IH(P). pricing
AB5074P Anti-Amyloid Antibody, β 1-40 This Anti-Amyloid Antibody, β 1-40 is validated for use in ELISA, IH, WB for the detection of Amyloid. pricing
AB5076 Anti-Amyloid Antibody, β 1-40/42 Anti-Amyloid Antibody, β 1-40/42 is an antibody against Amyloid for use in ELISA, IH & WB. pricing
AB5737 Anti-Amyloid Antibody, β 1-40, aβ Detect Amyloid using this Anti-Amyloid Antibody, β 1-40, aβ validated for use in ELISA. pricing
MAB5226 Anti-Amyloid Antibody, β 1-40, clone OM16 Anti-Amyloid Antibody, β 1-40, clone OM16 detects level of Amyloid & has been published & validated for use in ELISA & WB. pricing
AB5306 Anti-Amyloid Antibody, β 37-42, aβ Detect Amyloid using this Anti-Amyloid Antibody, β 37-42, aβ validated for use in ELISA, IH(P). pricing
AB1510 Anti-Amyloid β Antibody, aa1-14 h β-amyloid Anti-Amyloid Antibody, β, aa1-14 h β-amyloid detects level of Amyloid & has been published & validated for use in WB, IH. pricing
MABN10 Anti-Amyloid β Antibody, clone W0-2 Detect Amyloid β using this Anti-Amyloid β Antibody, clone W0-2 validated for use in WB, IH, ELISA. pricing
MABN779 Anti-Amyloid Beta 3NTyr10 Antibody, clone 4A5E8 Anti-Amyloid Beta 3NTyr10 Antibody, clone 4A5E8, Cat. No. MABN779, is a highly specific mouse monoclonal antibody that targets 3NTyr10 and has been tested in ELISA and Immunohistochemistry. pricing
AB2500 Anti-Amyloid beta A4 protein Antibody Detect Amyloid beta A4 protein using this Anti-Amyloid beta A4 protein Antibody validated for use in IH & WB. pricing
MABN2273 Anti-Amyloid Beta A4 protein Antibody, clone 2D8 Anti-Amyloid Beta A4 protein, clone 2D8 Antibody, Cat. No. MABN2273, is a highly specific rat monoclonal antibody that targets Amyloid beta A4 protein and has been tested in Immunoprecipitation and Western Blotting. pricing
MABN2295 Anti-Amyloid beta A4 protein Antibody, clone 2E9 Anti-Amyloid beta A4 protein, clone 2E9 Antibody, Cat. No. MABN2295, is a highly specific rat monoclonal antibody that targets Amyloid beta A4 protein and has been tested in Immunofluorescence, Immunoprecipitation, and Western Blotting. pricing
MAB8768 Anti-Amyloid beta A4 protein Antibody, clone MM26-2.1.3 Anti-Amyloid beta A4 protein Antibody, clone MM26-2.1.3 detects level of Amyloid beta A4 protein & has been published & validated for use in IH, WB, ELISA & IC. pricing
05-831-I Anti-Amyloid Beta (ABeta) x-42 Antibody, clone 12F4 Anti-Amyloid Beta (ABeta) x-42, clone 12F4 is an antibody targeting the Amyloid Beta (ABeta) x-42 protein, validated for use in IHC & ELISA. pricing
MABN637 Anti-Amyloid beta fibrils, clone M64, Rabbit Monoclonal Antibody This Anti-Amyloid beta fibrils, clone M64, Rabbit Monoclonal Antibody is validated for use in Dot Blot and Western Blotting and Immunohistochemistry and Immunoprecipitation for the detection of Amyloid beta fibrils. pricing
MABN640 Anti-Amyloid beta fibrils, clone M98, Rabbit Monoclonal Antibody This Anti-Amyloid beta fibrils, clone M98, Rabbit Monoclonal Antibody is validated for use in Dot Blot and Western Blotting and Immunohistochemistry for the detection of Amyloid beta fibrils. pricing
MABN254 Anti-amyloid beta peptide (MOAB-2), pan Antibody, clone 6C3 Anti-amyloid beta peptide (MOAB-2), pan Antibody, clone 6C3 is an antibody against amyloid beta peptide (MOAB-2), pan, clone 6C3 for use in western blotting, IHC (Paraffin), Immunofluorescence, IP, Dot Blot. pricing
MABN687 Anti-β-amyloid fibril-specific, clone B10, AP Antibody MABN687 is an antibody against β-amyloid fibril-specific for use in Immunohistochemistry, Dot Blot, ELISA, Immunoprecipitation, Immunofluorescence. pricing
MABN1839 Anti-Amyloid-β (oligomer) Antibody, clone F11G3 This Anti-Amyloid-β (oligomer) Antibody, clone F11G3 is validated for use in Western Blotting, Dot Blot, ELISA, Immunofluorescence, Immunoprecipitation for the detection of Amyloid-β. pricing
AB9234 Anti-Amyloid Oligomer Antibody, αβ, oligomeric Anti-Amyloid Oligomer Antibody, αβ, oligomeric is an antibody against Amyloid Oligomer for use in ELISA, IF, IH, IH(P), IP & WB. pricing
AB1593 Anti-Amyloid Precursor Protein Antibody, a.a. 44-63 Anti-Amyloid Precursor Protein Antibody, a.a. 44-63 is an antibody against Amyloid Precursor Protein for use in ELISA, IF, WB, IH, IH(P). pricing
MAB349 Anti-Amyloid Precursor Protein Antibody, A4(695), clone 1.D5 This Anti-Amyloid Precursor Protein Antibody, A4(695), clone 1.D5 is validated for use in WB for the detection of Amyloid Precursor Protein. pricing
AB5352 Anti-Amyloid Precursor Protein Antibody, CT Detect Amyloid Precursor Protein using this Anti-Amyloid Precursor Protein Antibody, C-terminus validated for use in IC, IH, IP & WB. pricing
AB5988P Anti-Amyloid Precursor Protein Antibody, Domain 770 Anti-Amyloid Precursor Protein Antibody, Domain 770 detects level of Amyloid Precursor Protein & has been published & validated for use in IP, WB, IC, IH. pricing
AB5302 Anti-Amyloid Precursor Protein Antibody, KPI Domain Anti-Amyloid Precursor Protein Antibody, KPI Domain is an antibody against Amyloid Precursor Protein for use in IP, WB, IC, IH. pricing
MAB5354 Anti-Amyloid β Precursor Protein Antibody, KPI domain, clone 4.1 Anti-Amyloid β Precursor Protein Antibody, KPI domain, clone 4.1 detects level of Amyloid β Precursor Protein & has been published & validated for use in ELISA, WB, IH. pricing
MAB5228 Anti-Amyloid Precursor Protein Antibody, Secretory, clone OM84 Anti-Amyloid Precursor Protein Antibody, Secretory, clone OM84 detects level of Amyloid Precursor Protein & has been published & validated for use in ELISA & WB. pricing
AB5300 Anti-Amyloid Precursor Protein Antibody, universal This Anti-Amyloid Precursor Protein Antibody, universal is validated for use in IP, WB for the detection of Amyloid Precursor Protein. pricing
MAB348-AF647 Anti-APP A4, a.a. 66-81 of APP {NT} Antibody, clone 22C11, Alexa Fluor® 647 Conjugate Anti-APP A4, a.a. 66-81 of APP {NT} Antibody, clone 22C11, Alexa Fluor® 647 Conjugate is an antibody against APP A4 for use in Immunocytochemistry. pricing
IHCR1002-6 Anti-APP A4 Antibody, a.a. 66-81 (NT), Prediluted, clone 22C11 Detect Alzheimer Precursor Protein A4 using this Anti-APP A4 Antibody, a.a. 66-81 (N-terminus), Prediluted, clone 22C11 validated for use in IH(P). pricing
MAB348 Anti-APP A4 Antibody, a.a. 66-81 of APP {NT}, clone 22C11 Anti-APP A4 Antibody, a.a. 66-81 of APP {N-terminus}, clone 22C11 is an antibody against Alzheimer Precursor Protein A4 for use in IF, IH, IH(P) & WB with more than 85 product citations. pricing
MAB348-100UL Anti-APP A4 Antibody, a.a. 66-81 of APP (NT), clone 22C11 Anti-APP A4 Antibody, a.a. 66-81 of APP (N-terminus), clone 22C11 detects level of Alzheimer Precursor Protein A4 & has been published & validated for use in IF, IH, IH(P) & WB. pricing
MAB348-AF555 Anti-APP A4 Antibody, a.a. 66-81 of APP {NT}, clone 22C11, Alexa Fluor® 555 Anti-APP A4 Antibody, a.a. 66-81 of APP {NT}, clone 22C11, Alexa Fluor® 555 is an antibody against APP A4 for use in Immunocytochemistry. pricing
07-667 Anti-APP Antibody Anti-APP Antibody detects level of APP & has been published & validated for use in IP & WB. pricing
ABN1643 Anti-APP Antibody, AEP-cleaved (373N) Anti-APP, AEP-cleaved (373N), Cat. No. ABN1643, is a highly specific rabbit polyclonal antibody that targets the N-terminal fragment of AEP-cleaved APP at residue 373 (373N) and has been tested in Immunohistochemistry and Western Blotting. pricing
ABN1642 Anti-APP Antibody, AEP-cleaved (585N) Anti-APP, AEP-cleaved (585N), Cat. No. ABN1642, is a highly specific rabbit polyclonal antibody that targets the N-terminal fragment of AEP-cleaved APP at residue 585 (585N) and has been tested in Immunohistochemistry and Western Blotting. pricing
MAB343 Anti-APP Antibody, APP 643-695 CT fragment, clone 2.F2.19B4 This Anti-APP Antibody, APP 643-695 C-terminal fragment, clone 2.F2.19B4 is validated for use in IH(P), WB for the detection of Alzheimer Precursor Protein. pricing
MAB343-C Anti-APP Antibody, CT, clone 2.F2.19B4, Ascites Free This Anti-APP Antibody, CT, clone 2.F2.19B4, Ascites Free is validated for use in Immunohistochemistry (Paraffin), Immunocytochemistry, Immunoprecipitation, Western Blotting, Immunofluorescence, Affinity Binding Assay for the detection of APP. pricing
MABN381 Anti-APP-C99 Antibody, clone mC99(1-7) Anti-APP-C99 Antibody, clone mC99(1-7) is a highly specific mouse monoclonal antibody, that targets APP & has been tested in western blotting, IP, ICC & IHC. pricing
MABN380 Anti-APP-C99 Antibody, clone mC99(70–80) Anti-APP-C99 Antibody, clone mC99(70–80) is a highly specific mouse monoclonal antibody, that targets APP & has been tested in western blotting, IP, IHC & ICC. pricing
ABN1641 Anti-APP585C Anti-APP585C, Cat. No. ABN1641, is a highly specific rabbit polyclonal antibody that targets Amyloid beta A4 protein and has been tested in Immunohistochemistry (Paraffin) and Western Blotting. pricing
AB5078P Anti-Beta-Amyloid 1-42 Antibody Anti-Beta-Amyloid 1-42 Antibody is an antibody against Beta-Amyloid 1-42 for use in ELISA, IH, IH(P) & WB. pricing
MABN879 Anti-phospho-Amyloid beta Antibody (Ser26), clone 5H11C10 Anti-phospho-Amyloid beta (Ser26), clone 5H11C10, Cat. No. MABN879, is a highly specific mouse monoclonal antibody, that targets amyloid beta peptides Ser26 phosphorylation and has been tested in ELISA, Immunofluorescence, Western Blotting. pricing
MABN878 Anti-phospho-Amyloid beta (Ser8) Antibody, clone 1E4E11 Anti-phospho-Amyloid beta (Ser8) Antibody, clone 1E4E11 is an antibody against phospho-Amyloid beta (Ser8) for use in Western Blotting, Enzyme Immunoassay (ELISA), Immunohistochemistry, Immunofluorescence. pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000484 siRNAs that have been validated in the lab human pricing
NM_201413 Rosetta Predictions human pricing
NM_201414 Rosetta Predictions human pricing
NM_019288 Rosetta Predictions rat pricing
NM_007471 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000484 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00185800 validated 2273
1 SASI_Hs01_00185799 validated 544
1 SASI_Hs01_00185801 validated 313
2 SASI_Hs02_00302631 predicted 549
3 SASI_Hs02_00302632 predicted 1970
4 SASI_Hs01_00185803 predicted 1796
5 SASI_Hs01_00185805 predicted 582
6 SASI_Hs02_00302633 predicted 2285
7 SASI_Hs01_00185808 predicted 1714
8 SASI_Hs02_00302634 predicted 1856
9 SASI_Hs02_00302635 predicted 608
10 SASI_Hs01_00185802 predicted 2224
11 SASI_Hs01_00185804 predicted 2284
12 SASI_Hs01_00185806 predicted 2585
13 SASI_Hs01_00185807 predicted 2309
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201413 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00372947 predicted 552
2 SASI_Hs01_00068225 predicted 537
3 SASI_Hs01_00068227 predicted 308
4 SASI_Hs02_00372948 predicted 1911
5 SASI_Hs01_00068229 predicted 1735
6 SASI_Hs01_00068231 predicted 579
7 SASI_Hs02_00372949 predicted 2226
8 SASI_Hs01_00068234 predicted 1656
9 SASI_Hs02_00372950 predicted 1804
10 SASI_Hs02_00372951 predicted 611
11 SASI_Hs01_00068226 predicted 2218
12 SASI_Hs01_00068228 predicted 2159
13 SASI_Hs01_00068230 predicted 2219
14 SASI_Hs01_00068232 predicted 2537
15 SASI_Hs01_00068233 predicted 2251
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201414 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00372952 predicted 550
2 SASI_Hs01_00177201 predicted 540
3 SASI_Hs01_00177203 predicted 308
4 SASI_Hs02_00372953 predicted 1745
5 SASI_Hs01_00177205 predicted 1566
6 SASI_Hs01_00177207 predicted 581
7 SASI_Hs02_00372954 predicted 2065
8 SASI_Hs01_00177210 predicted 1488
9 SASI_Hs02_00372955 predicted 1635
10 SASI_Hs02_00372956 predicted 611
11 SASI_Hs01_00177202 predicted 2050
12 SASI_Hs01_00177204 predicted 1995
13 SASI_Hs01_00177206 predicted 2059
14 SASI_Hs01_00177208 predicted 2369
15 SASI_Hs01_00177209 predicted 2083
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019288 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00086595 predicted 366
2 SASI_Rn01_00086596 predicted 2006
3 SASI_Rn01_00086597 predicted 2095
4 SASI_Rn01_00086598 predicted 1000
5 SASI_Rn01_00086600 predicted 606
6 SASI_Rn01_00086601 predicted 1852
7 SASI_Rn02_00262230 predicted 368
8 SASI_Rn01_00086602 predicted 1623
9 SASI_Rn01_00086603 predicted 497
10 SASI_Rn01_00086604 predicted 501
11 SASI_Rn01_00086599 predicted 366
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007471 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00068884 predicted 253
2 SASI_Mm01_00068885 predicted 1956
3 SASI_Mm01_00068886 predicted 1938
4 SASI_Mm01_00068887 predicted 1907
5 SASI_Mm01_00068888 predicted 1986
6 SASI_Mm01_00068889 predicted 271
7 SASI_Mm01_00068890 predicted 621
8 SASI_Mm01_00068891 predicted 2180
9 SASI_Mm01_00068892 predicted 1522
10 SASI_Mm01_00068893 predicted 1251
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000484
VALIDATED
APP MISSION shRNA Bacterial Glycerol Stock
amyloid beta (A4) precursor protein
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000349493    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000484.3-3208s21c1
Sequence:CCGGCCCTGTTCATTGTAAGCACTTCTCGAGAAGTGCTTACAATGAACAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000484.3-1237s21c1
Sequence:CCGGCCCAAAGTTTACTCAAGACTACTCGAGTAGTCTTGAGTAAACTTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000484.3-837s21c1
Sequence:CCGGGCAGACACAGACTATGCAGATCTCGAGATCTGCATAGTCTGTGTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000484.3-1982s21c1
Sequence:CCGGGCCATCTTTGACCGAAACGAACTCGAGTTCGTTTCGGTCAAAGATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006705    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_000484.2-3202s1c1
Sequence:CCGGCCCTGTTCATTGTAAGCACTTCTCGAGAAGTGCTTACAATGAACAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_000484.2-831s1c1
Sequence:CCGGGCAGACACAGACTATGCAGATCTCGAGATCTGCATAGTCTGTGTCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000484.2-540s1c1
Sequence:CCGGCGCTGCTTAGTTGGTGAGTTTCTCGAGAAACTCACCAACTAAGCAGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_000484.2-1231s1c1
Sequence:CCGGCCCAAAGTTTACTCAAGACTACTCGAGTAGTCTTGAGTAAACTTTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_000484.2-1976s1c1
Sequence:CCGGGCCATCTTTGACCGAAACGAACTCGAGTTCGTTTCGGTCAAAGATGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000484
VALIDATED
APP MISSION shRNA shRNA Plasmid DNA
amyloid beta (A4) precursor protein
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000349493    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000484.3-3208s21c1
Sequence:CCGGCCCTGTTCATTGTAAGCACTTCTCGAGAAGTGCTTACAATGAACAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000484.3-1237s21c1
Sequence:CCGGCCCAAAGTTTACTCAAGACTACTCGAGTAGTCTTGAGTAAACTTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000484.3-837s21c1
Sequence:CCGGGCAGACACAGACTATGCAGATCTCGAGATCTGCATAGTCTGTGTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000484.3-1982s21c1
Sequence:CCGGGCCATCTTTGACCGAAACGAACTCGAGTTCGTTTCGGTCAAAGATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006705    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_000484.2-3202s1c1
Sequence:CCGGCCCTGTTCATTGTAAGCACTTCTCGAGAAGTGCTTACAATGAACAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_000484.2-831s1c1
Sequence:CCGGGCAGACACAGACTATGCAGATCTCGAGATCTGCATAGTCTGTGTCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000484.2-540s1c1
Sequence:CCGGCGCTGCTTAGTTGGTGAGTTTCTCGAGAAACTCACCAACTAAGCAGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_000484.2-1231s1c1
Sequence:CCGGCCCAAAGTTTACTCAAGACTACTCGAGTAGTCTTGAGTAAACTTTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_000484.2-1976s1c1
Sequence:CCGGGCCATCTTTGACCGAAACGAACTCGAGTTCGTTTCGGTCAAAGATGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000484
VALIDATED
APP MISSION shRNA Lentiviral Transduction Particles
amyloid beta (A4) precursor protein
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000349493    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000484.3-3208s21c1
Sequence:CCGGCCCTGTTCATTGTAAGCACTTCTCGAGAAGTGCTTACAATGAACAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000484.3-1237s21c1
Sequence:CCGGCCCAAAGTTTACTCAAGACTACTCGAGTAGTCTTGAGTAAACTTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000484.3-837s21c1
Sequence:CCGGGCAGACACAGACTATGCAGATCTCGAGATCTGCATAGTCTGTGTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000484.3-1982s21c1
Sequence:CCGGGCCATCTTTGACCGAAACGAACTCGAGTTCGTTTCGGTCAAAGATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006705    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_000484.2-3202s1c1
Sequence:CCGGCCCTGTTCATTGTAAGCACTTCTCGAGAAGTGCTTACAATGAACAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_000484.2-831s1c1
Sequence:CCGGGCAGACACAGACTATGCAGATCTCGAGATCTGCATAGTCTGTGTCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000484.2-540s1c1
Sequence:CCGGCGCTGCTTAGTTGGTGAGTTTCTCGAGAAACTCACCAACTAAGCAGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_000484.2-1231s1c1
Sequence:CCGGCCCAAAGTTTACTCAAGACTACTCGAGTAGTCTTGAGTAAACTTTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_000484.2-1976s1c1
Sequence:CCGGGCCATCTTTGACCGAAACGAACTCGAGTTCGTTTCGGTCAAAGATGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007471
APP MISSION shRNA Bacterial Glycerol Stock
amyloid beta (A4) precursor protein
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000301470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007471.2-1583s21c1
Sequence:CCGGGCTGAGGAGATTCAAGATGAACTCGAGTTCATCTTGAATCTCCTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007471.2-491s21c1
Sequence:CCGGCGTTGCCTAGTTGGTGAGTTTCTCGAGAAACTCACCAACTAGGCAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007471.2-2185s21c1
Sequence:CCGGCGGATATGAGAATCCAACTTACTCGAGTAAGTTGGATTCTCATATCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301544    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007471.2-2948s21c1
Sequence:CCGGCCTGTTCATCATAAGCACTTTCTCGAGAAAGTGCTTATGATGAACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054873    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007471.2-2948s1c1
Sequence:CCGGCCTGTTCATCATAAGCACTTTCTCGAGAAAGTGCTTATGATGAACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007471.2-2185s1c1
Sequence:CCGGCGGATATGAGAATCCAACTTACTCGAGTAAGTTGGATTCTCATATCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007471.2-491s1c1
Sequence:CCGGCGTTGCCTAGTTGGTGAGTTTCTCGAGAAACTCACCAACTAGGCAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007471.2-848s1c1
Sequence:CCGGGCTGATGTTGAGGAAGAGGAACTCGAGTTCCTCTTCCTCAACATCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007471.2-1583s1c1
Sequence:CCGGGCTGAGGAGATTCAAGATGAACTCGAGTTCATCTTGAATCTCCTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007471
APP MISSION shRNA shRNA Plasmid DNA
amyloid beta (A4) precursor protein
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000301470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007471.2-1583s21c1
Sequence:CCGGGCTGAGGAGATTCAAGATGAACTCGAGTTCATCTTGAATCTCCTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007471.2-491s21c1
Sequence:CCGGCGTTGCCTAGTTGGTGAGTTTCTCGAGAAACTCACCAACTAGGCAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007471.2-2185s21c1
Sequence:CCGGCGGATATGAGAATCCAACTTACTCGAGTAAGTTGGATTCTCATATCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301544    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007471.2-2948s21c1
Sequence:CCGGCCTGTTCATCATAAGCACTTTCTCGAGAAAGTGCTTATGATGAACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054873    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007471.2-2948s1c1
Sequence:CCGGCCTGTTCATCATAAGCACTTTCTCGAGAAAGTGCTTATGATGAACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007471.2-2185s1c1
Sequence:CCGGCGGATATGAGAATCCAACTTACTCGAGTAAGTTGGATTCTCATATCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007471.2-491s1c1
Sequence:CCGGCGTTGCCTAGTTGGTGAGTTTCTCGAGAAACTCACCAACTAGGCAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007471.2-848s1c1
Sequence:CCGGGCTGATGTTGAGGAAGAGGAACTCGAGTTCCTCTTCCTCAACATCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007471.2-1583s1c1
Sequence:CCGGGCTGAGGAGATTCAAGATGAACTCGAGTTCATCTTGAATCTCCTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007471
APP MISSION shRNA Lentiviral Transduction Particles
amyloid beta (A4) precursor protein
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000301470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007471.2-1583s21c1
Sequence:CCGGGCTGAGGAGATTCAAGATGAACTCGAGTTCATCTTGAATCTCCTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007471.2-491s21c1
Sequence:CCGGCGTTGCCTAGTTGGTGAGTTTCTCGAGAAACTCACCAACTAGGCAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007471.2-2185s21c1
Sequence:CCGGCGGATATGAGAATCCAACTTACTCGAGTAAGTTGGATTCTCATATCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301544    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007471.2-2948s21c1
Sequence:CCGGCCTGTTCATCATAAGCACTTTCTCGAGAAAGTGCTTATGATGAACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054873    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007471.2-2948s1c1
Sequence:CCGGCCTGTTCATCATAAGCACTTTCTCGAGAAAGTGCTTATGATGAACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007471.2-2185s1c1
Sequence:CCGGCGGATATGAGAATCCAACTTACTCGAGTAAGTTGGATTCTCATATCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007471.2-491s1c1
Sequence:CCGGCGTTGCCTAGTTGGTGAGTTTCTCGAGAAACTCACCAACTAGGCAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007471.2-848s1c1
Sequence:CCGGGCTGATGTTGAGGAAGAGGAACTCGAGTTCCTCTTCCTCAACATCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007471.2-1583s1c1
Sequence:CCGGGCTGAGGAGATTCAAGATGAACTCGAGTTCATCTTGAATCTCCTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)