EMAIL THIS PAGE TO A FRIEND

APPBP2

amyloid beta precursor protein (cytoplasmic tail) binding protein 2

233 Gene Product Result for
Synonyms: APP-BP2 HS.84084 PAT1
UniProtKB ID: Q92624, A8K862, O95095, Q8WVC9
Gene ID:
Human(10513) Summary: The protein encoded by this gene interacts with microtubules and is functionally associated with beta-amyloid precursor protein transport and/or processing. The beta-amyloid precursor protein is a cell surface protein with signal-transducing properties, and it is thought to play a role in the pathogenesis of Alzheimer's disease. This gene has been found to be highly expressed in breast cancer. Multiple polyadenylation sites have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(66884) amyloid beta precursor protein (cytoplasmic tail) binding protein 2
Rat(303396) amyloid beta precursor protein (cytoplasmic tail) binding protein 2
Zebrafish(322995) amyloid beta precursor protein (cytoplasmic tail) binding protein 2
cow(505734) amyloid beta precursor protein (cytoplasmic tail) binding protein 2
dog(480588) amyloid beta precursor protein (cytoplasmic tail) binding protein 2
Horse(100071336) amyloid beta precursor protein (cytoplasmic tail) binding protein 2
domestic cat(101089307) amyloid beta precursor protein (cytoplasmic tail) binding protein 2
chicken(417645) amyloid beta precursor protein (cytoplasmic tail) binding protein 2
sheep(101108927) amyloid beta precursor protein (cytoplasmic tail) binding protein 2
domestic guinea pig(100731836) amyloid beta precursor protein (cytoplasmic tail) binding protein 2
naked mole-rat(101699217) amyloid beta precursor protein (cytoplasmic tail) binding protein 2
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006380 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006380 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006380 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025825 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025825 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025825 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006380 Rosetta Predictions human pricing
NM_001100969 Rosetta Predictions rat pricing
NM_025825 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006380 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00098536 predicted 1447
2 SASI_Hs01_00098538 predicted 1846
3 SASI_Hs01_00098539 predicted 608
4 SASI_Hs01_00098540 predicted 1777
5 SASI_Hs02_00341443 predicted 1580
6 SASI_Hs01_00098541 predicted 1040
7 SASI_Hs01_00098542 predicted 542
8 SASI_Hs01_00098543 predicted 1761
9 SASI_Hs01_00098544 predicted 1905
10 SASI_Hs01_00098545 predicted 1100
11 SASI_Hs01_00098537 predicted 1171
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100969 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00210832 predicted 1611
2 SASI_Rn02_00210833 predicted 1081
3 SASI_Rn02_00210834 predicted 1062
4 SASI_Rn02_00210835 predicted 1524
5 SASI_Rn02_00210836 predicted 1278
6 SASI_Rn02_00210837 predicted 613
7 SASI_Rn02_00210838 predicted 541
8 SASI_Rn02_00210839 predicted 784
9 SASI_Rn02_00210840 predicted 1568
10 SASI_Rn02_00210841 predicted 758
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025825 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00172359 predicted 1189
2 SASI_Mm01_00172360 predicted 1122
3 SASI_Mm01_00172361 predicted 1449
4 SASI_Mm02_00329089 predicted 1865
5 SASI_Mm01_00172362 predicted 1325
6 SASI_Mm01_00172363 predicted 1927
7 SASI_Mm01_00172365 predicted 530
8 SASI_Mm01_00172366 predicted 881
9 SASI_Mm01_00172367 predicted 1868
10 SASI_Mm01_00172368 predicted 558
11 SASI_Mm01_00172364 predicted 682
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006380
VALIDATED
APPBP2 MISSION shRNA Bacterial Glycerol Stock
amyloid beta precursor protein (cytoplasmic tail) binding protein 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000065278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006380.2-1009s1c1
Sequence:CCGGCCAGTGAAAGTTGTGGTGGATCTCGAGATCCACCACAACTTTCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006380.2-1630s1c1
Sequence:CCGGGCTGAAGAAATGCACATCAAACTCGAGTTTGATGTGCATTTCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006380.2-1933s1c1
Sequence:CCGGCGGCAATATTCAGTGACAGATCTCGAGATCTGTCACTGAATATTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006380.2-598s1c1
Sequence:CCGGCGGTGCTCTTATATAGCAGAACTCGAGTTCTGCTATATAAGAGCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_006380.2-394s1c1
Sequence:CCGGCCCGAGAACATCCAGTTTGATCTCGAGATCAAACTGGATGTTCTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_006380.2-1009s21c1
Sequence:CCGGCCAGTGAAAGTTGTGGTGGATCTCGAGATCCACCACAACTTTCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_006380.2-1630s21c1
Sequence:CCGGGCTGAAGAAATGCACATCAAACTCGAGTTTGATGTGCATTTCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293907    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_006380.2-2205s21c1
Sequence:CCGGCTGTAGGAATAAGCATATATTCTCGAGAATATATGCTTATTCCTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006380.2-1150s21c1
Sequence:CCGGTCTGATACACTGCTAGATTATCTCGAGATAATCTAGCAGTGTATCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_006380.2-1865s21c1
Sequence:CCGGCCATTGGAAATTACGAGAAAGCTCGAGCTTTCTCGTAATTTCCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006380
VALIDATED
APPBP2 MISSION shRNA shRNA Plasmid DNA
amyloid beta precursor protein (cytoplasmic tail) binding protein 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000065278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006380.2-1009s1c1
Sequence:CCGGCCAGTGAAAGTTGTGGTGGATCTCGAGATCCACCACAACTTTCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006380.2-1630s1c1
Sequence:CCGGGCTGAAGAAATGCACATCAAACTCGAGTTTGATGTGCATTTCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006380.2-1933s1c1
Sequence:CCGGCGGCAATATTCAGTGACAGATCTCGAGATCTGTCACTGAATATTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006380.2-598s1c1
Sequence:CCGGCGGTGCTCTTATATAGCAGAACTCGAGTTCTGCTATATAAGAGCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_006380.2-394s1c1
Sequence:CCGGCCCGAGAACATCCAGTTTGATCTCGAGATCAAACTGGATGTTCTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_006380.2-1009s21c1
Sequence:CCGGCCAGTGAAAGTTGTGGTGGATCTCGAGATCCACCACAACTTTCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_006380.2-1630s21c1
Sequence:CCGGGCTGAAGAAATGCACATCAAACTCGAGTTTGATGTGCATTTCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293907    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_006380.2-2205s21c1
Sequence:CCGGCTGTAGGAATAAGCATATATTCTCGAGAATATATGCTTATTCCTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006380.2-1150s21c1
Sequence:CCGGTCTGATACACTGCTAGATTATCTCGAGATAATCTAGCAGTGTATCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_006380.2-1865s21c1
Sequence:CCGGCCATTGGAAATTACGAGAAAGCTCGAGCTTTCTCGTAATTTCCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006380
VALIDATED
APPBP2 MISSION shRNA Lentiviral Transduction Particles
amyloid beta precursor protein (cytoplasmic tail) binding protein 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000065278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006380.2-1009s1c1
Sequence:CCGGCCAGTGAAAGTTGTGGTGGATCTCGAGATCCACCACAACTTTCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006380.2-1630s1c1
Sequence:CCGGGCTGAAGAAATGCACATCAAACTCGAGTTTGATGTGCATTTCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006380.2-1933s1c1
Sequence:CCGGCGGCAATATTCAGTGACAGATCTCGAGATCTGTCACTGAATATTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006380.2-598s1c1
Sequence:CCGGCGGTGCTCTTATATAGCAGAACTCGAGTTCTGCTATATAAGAGCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_006380.2-394s1c1
Sequence:CCGGCCCGAGAACATCCAGTTTGATCTCGAGATCAAACTGGATGTTCTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_006380.2-1009s21c1
Sequence:CCGGCCAGTGAAAGTTGTGGTGGATCTCGAGATCCACCACAACTTTCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_006380.2-1630s21c1
Sequence:CCGGGCTGAAGAAATGCACATCAAACTCGAGTTTGATGTGCATTTCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293907    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_006380.2-2205s21c1
Sequence:CCGGCTGTAGGAATAAGCATATATTCTCGAGAATATATGCTTATTCCTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006380.2-1150s21c1
Sequence:CCGGTCTGATACACTGCTAGATTATCTCGAGATAATCTAGCAGTGTATCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_006380.2-1865s21c1
Sequence:CCGGCCATTGGAAATTACGAGAAAGCTCGAGCTTTCTCGTAATTTCCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025825
APPBP2 MISSION shRNA Bacterial Glycerol Stock
amyloid beta precursor protein (cytoplasmic tail) binding protein 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000100445    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025825.2-2263s1c1
Sequence:CCGGCGTGTATAAGTAGTCCCACATCTCGAGATGTGGGACTACTTATACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025825.2-1623s1c1
Sequence:CCGGGCTCTATCAGTCAATGAGAAACTCGAGTTTCTCATTGACTGATAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025825.2-1079s1c1
Sequence:CCGGGTGTAGTCAAACGTGAATTTACTCGAGTAAATTCACGTTTGACTACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025825.2-435s1c1
Sequence:CCGGCGACGTTTACTACAAGCTTTACTCGAGTAAAGCTTGTAGTAAACGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025825.2-1033s1c1
Sequence:CCGGCCAGTCAAAGTTGTGGTGGATCTCGAGATCCACCACAACTTTGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329206    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025825.3-2219s21c1
Sequence:CCGGTCCTGTAGAATAAGCATATATCTCGAGATATATGCTTATTCTACAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025825.3-422s21c1
Sequence:CCGGGAATATCCAGTTCGACGTTTACTCGAGTAAACGTCGAACTGGATATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025825.3-1945s21c1
Sequence:CCGGGGTTGCGAGATCGACAGTATTCTCGAGAATACTGTCGATCTCGCAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025825.3-1173s21c1
Sequence:CCGGTCTGACACACTGCTAGATTATCTCGAGATAATCTAGCAGTGTGTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025825.3-1130s21c1
Sequence:CCGGGTATTTGGCACGAGATCATTTCTCGAGAAATGATCTCGTGCCAAATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025825
APPBP2 MISSION shRNA shRNA Plasmid DNA
amyloid beta precursor protein (cytoplasmic tail) binding protein 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000100445    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025825.2-2263s1c1
Sequence:CCGGCGTGTATAAGTAGTCCCACATCTCGAGATGTGGGACTACTTATACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025825.2-1623s1c1
Sequence:CCGGGCTCTATCAGTCAATGAGAAACTCGAGTTTCTCATTGACTGATAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025825.2-1079s1c1
Sequence:CCGGGTGTAGTCAAACGTGAATTTACTCGAGTAAATTCACGTTTGACTACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025825.2-435s1c1
Sequence:CCGGCGACGTTTACTACAAGCTTTACTCGAGTAAAGCTTGTAGTAAACGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025825.2-1033s1c1
Sequence:CCGGCCAGTCAAAGTTGTGGTGGATCTCGAGATCCACCACAACTTTGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329206    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025825.3-2219s21c1
Sequence:CCGGTCCTGTAGAATAAGCATATATCTCGAGATATATGCTTATTCTACAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025825.3-422s21c1
Sequence:CCGGGAATATCCAGTTCGACGTTTACTCGAGTAAACGTCGAACTGGATATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025825.3-1945s21c1
Sequence:CCGGGGTTGCGAGATCGACAGTATTCTCGAGAATACTGTCGATCTCGCAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025825.3-1173s21c1
Sequence:CCGGTCTGACACACTGCTAGATTATCTCGAGATAATCTAGCAGTGTGTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025825.3-1130s21c1
Sequence:CCGGGTATTTGGCACGAGATCATTTCTCGAGAAATGATCTCGTGCCAAATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025825
APPBP2 MISSION shRNA Lentiviral Transduction Particles
amyloid beta precursor protein (cytoplasmic tail) binding protein 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000100445    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025825.2-2263s1c1
Sequence:CCGGCGTGTATAAGTAGTCCCACATCTCGAGATGTGGGACTACTTATACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025825.2-1623s1c1
Sequence:CCGGGCTCTATCAGTCAATGAGAAACTCGAGTTTCTCATTGACTGATAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025825.2-1079s1c1
Sequence:CCGGGTGTAGTCAAACGTGAATTTACTCGAGTAAATTCACGTTTGACTACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025825.2-435s1c1
Sequence:CCGGCGACGTTTACTACAAGCTTTACTCGAGTAAAGCTTGTAGTAAACGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025825.2-1033s1c1
Sequence:CCGGCCAGTCAAAGTTGTGGTGGATCTCGAGATCCACCACAACTTTGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329206    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025825.3-2219s21c1
Sequence:CCGGTCCTGTAGAATAAGCATATATCTCGAGATATATGCTTATTCTACAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025825.3-422s21c1
Sequence:CCGGGAATATCCAGTTCGACGTTTACTCGAGTAAACGTCGAACTGGATATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025825.3-1945s21c1
Sequence:CCGGGGTTGCGAGATCGACAGTATTCTCGAGAATACTGTCGATCTCGCAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025825.3-1173s21c1
Sequence:CCGGTCTGACACACTGCTAGATTATCTCGAGATAATCTAGCAGTGTGTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025825.3-1130s21c1
Sequence:CCGGGTATTTGGCACGAGATCATTTCTCGAGAAATGATCTCGTGCCAAATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks