EMAIL THIS PAGE TO A FRIEND

APPL1

adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 1

Synonyms: APPL DIP13alpha
UniProtKB ID: Q9UKG1, Q9P2B9
Gene ID:
Human(26060) Summary: The protein encoded by this gene has been shown to be involved in the regulation of cell proliferation, and in the crosstalk between the adiponectin signalling and insulin signalling pathways. The encoded protein binds many other proteins, including RAB5A, DCC, AKT2, PIK3CA, adiponectin receptors, and proteins of the NuRD/MeCP1 complex. This protein is found associated with endosomal membranes, but can be released by EGF and translocated to the nucleus. [provided by RefSeq, Jul 2008]
Mouse(72993) adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 1
Rat(290537) adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 1
Zebrafish(571540) adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 1
chicken(416002) adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 1
domestic cat(101096960) adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 1
cow(517850) adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 1
Horse(100058653) adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 1
dog(484716) adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 1
naked mole-rat(101703342) adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 1
domestic guinea pig(100724445) adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 1
sheep(101109218) adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 1
Domestic Rabbit(100353097) adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 1
197 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145221 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145221 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145221 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_012096 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012096 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012096 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012096 Rosetta Predictions human pricing
XM_214273 Rosetta Predictions rat pricing
XR_007603 Rosetta Predictions rat pricing
NM_145221 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012096 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00137721 predicted 1511
2 SASI_Hs02_00343599 predicted 311
3 SASI_Hs01_00137723 predicted 1224
4 SASI_Hs01_00137725 predicted 1498
5 SASI_Hs02_00343600 predicted 959
6 SASI_Hs01_00137726 predicted 1760
7 SASI_Hs01_00137727 predicted 982
8 SASI_Hs01_00137728 predicted 1056
9 SASI_Hs01_00137729 predicted 865
10 SASI_Hs02_00343601 predicted 918
11 SASI_Hs01_00137722 predicted 1533
12 SASI_Hs01_00137724 predicted 1490
13 SASI_Hs01_00137730 predicted 1624
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_214273 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00185376 predicted 1842
2 SASI_Rn01_00185377 predicted 1968
3 SASI_Rn01_00185378 predicted 615
4 SASI_Rn01_00185379 predicted 552
5 SASI_Rn01_00185380 predicted 907
6 SASI_Rn01_00185381 predicted 2098
7 SASI_Rn01_00185382 predicted 977
8 SASI_Rn01_00185383 predicted 1106
9 SASI_Rn01_00185384 predicted 776
10 SASI_Rn01_00185385 predicted 1072
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_007603 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00174670 predicted 1450
2 SASI_Rn01_00174671 predicted 2829
3 SASI_Rn02_00415010 predicted 2772
4 SASI_Rn01_00174672 predicted 3389
5 SASI_Rn01_00174674 predicted 1582
6 SASI_Rn01_00174675 predicted 5456
7 SASI_Rn01_00174676 predicted 2750
8 SASI_Rn01_00174677 predicted 594
9 SASI_Rn02_00415011 predicted 251
10 SASI_Rn01_00174678 predicted 558
11 SASI_Rn01_00174669 predicted 1326
12 SASI_Rn01_00174673 predicted 389
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145221 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00151609 predicted 1445
2 SASI_Mm01_00151610 predicted 1700
3 SASI_Mm01_00151611 predicted 510
4 SASI_Mm02_00340597 predicted 2305
5 SASI_Mm01_00151613 predicted 374
6 SASI_Mm01_00151614 predicted 715
7 SASI_Mm01_00151616 predicted 1246
8 SASI_Mm01_00151617 predicted 453
9 SASI_Mm01_00151618 predicted 895
10 SASI_Mm02_00340598 predicted 966
11 SASI_Mm01_00151612 predicted 1185
12 SASI_Mm01_00151615 predicted 1775
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145221
VALIDATED
APPL1 MISSION shRNA Bacterial Glycerol Stock
adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 1
Mouse
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000352539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145221.2-398s21c1
Sequence:CCGGGCAGTACTTTCAACTCAACTTCTCGAGAAGTTGAGTTGAAAGTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145221.2-1890s21c1
Sequence:CCGGTGTCATCAGTCTGCTATATATCTCGAGATATATAGCAGACTGATGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340759    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145221.2-2339s21c1
Sequence:CCGGTGAACTTGATAACCGGTTATACTCGAGTATAACCGGTTATCAAGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215754    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145221.2-907s1c1
Sequence:CCGGGTTTCCCATCAATCGAAATTTCTCGAGAAATTTCGATTGATGGGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217195    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145221.2-221s1c1
Sequence:CCGGCAAGCTATGCATCGGATTTATCTCGAGATAAATCCGATGCATAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217598    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145221.2-512s1c1
Sequence:CCGGGATCATGATGCCGCAATTAATCTCGAGATTAATTGCGGCATCATGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145221.2-511s21c1
Sequence:CCGGTGATCATGATGCCGCAATTAACTCGAGTTAATTGCGGCATCATGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145221.2-220s21c1
Sequence:CCGGTCAAGCTATGCATCGGATTTACTCGAGTAAATCCGATGCATAGCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145221.1-363s1c1
Sequence:CCGGGCAGTACTTTCAACTCAACTTCTCGAGAAGTTGAGTTGAAAGTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145221.1-803s1c1
Sequence:CCGGGCAGCAGACAATAGAAGACTTCTCGAGAAGTCTTCTATTGTCTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145221.1-771s1c1
Sequence:CCGGCGAAGAGAAATGGATGGTGATCTCGAGATCACCATCCATTTCTCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145221.1-1765s1c1
Sequence:CCGGCGTGTGTAGTTCTGTATGCTACTCGAGTAGCATACAGAACTACACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173327    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145221.1-2015s1c1
Sequence:CCGGGCTCAGCAAACAGAAACAGATCTCGAGATCTGTTTCTGTTTGCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145221.1-1878s1c1
Sequence:CCGGGAATCAAACAATGAGGGAGAACTCGAGTTCTCCCTCATTGTTTGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145221
VALIDATED
APPL1 MISSION shRNA shRNA Plasmid DNA
adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 1
Mouse
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000352539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145221.2-398s21c1
Sequence:CCGGGCAGTACTTTCAACTCAACTTCTCGAGAAGTTGAGTTGAAAGTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145221.2-1890s21c1
Sequence:CCGGTGTCATCAGTCTGCTATATATCTCGAGATATATAGCAGACTGATGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340759    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145221.2-2339s21c1
Sequence:CCGGTGAACTTGATAACCGGTTATACTCGAGTATAACCGGTTATCAAGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215754    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145221.2-907s1c1
Sequence:CCGGGTTTCCCATCAATCGAAATTTCTCGAGAAATTTCGATTGATGGGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217195    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145221.2-221s1c1
Sequence:CCGGCAAGCTATGCATCGGATTTATCTCGAGATAAATCCGATGCATAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217598    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145221.2-512s1c1
Sequence:CCGGGATCATGATGCCGCAATTAATCTCGAGATTAATTGCGGCATCATGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145221.2-511s21c1
Sequence:CCGGTGATCATGATGCCGCAATTAACTCGAGTTAATTGCGGCATCATGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145221.2-220s21c1
Sequence:CCGGTCAAGCTATGCATCGGATTTACTCGAGTAAATCCGATGCATAGCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145221.1-363s1c1
Sequence:CCGGGCAGTACTTTCAACTCAACTTCTCGAGAAGTTGAGTTGAAAGTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145221.1-803s1c1
Sequence:CCGGGCAGCAGACAATAGAAGACTTCTCGAGAAGTCTTCTATTGTCTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145221.1-771s1c1
Sequence:CCGGCGAAGAGAAATGGATGGTGATCTCGAGATCACCATCCATTTCTCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145221.1-1765s1c1
Sequence:CCGGCGTGTGTAGTTCTGTATGCTACTCGAGTAGCATACAGAACTACACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173327    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145221.1-2015s1c1
Sequence:CCGGGCTCAGCAAACAGAAACAGATCTCGAGATCTGTTTCTGTTTGCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145221.1-1878s1c1
Sequence:CCGGGAATCAAACAATGAGGGAGAACTCGAGTTCTCCCTCATTGTTTGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145221
VALIDATED
APPL1 MISSION shRNA Lentiviral Transduction Particles
adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 1
Mouse
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000352539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145221.2-398s21c1
Sequence:CCGGGCAGTACTTTCAACTCAACTTCTCGAGAAGTTGAGTTGAAAGTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145221.2-1890s21c1
Sequence:CCGGTGTCATCAGTCTGCTATATATCTCGAGATATATAGCAGACTGATGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340759    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145221.2-2339s21c1
Sequence:CCGGTGAACTTGATAACCGGTTATACTCGAGTATAACCGGTTATCAAGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215754    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145221.2-907s1c1
Sequence:CCGGGTTTCCCATCAATCGAAATTTCTCGAGAAATTTCGATTGATGGGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217195    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145221.2-221s1c1
Sequence:CCGGCAAGCTATGCATCGGATTTATCTCGAGATAAATCCGATGCATAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217598    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145221.2-512s1c1
Sequence:CCGGGATCATGATGCCGCAATTAATCTCGAGATTAATTGCGGCATCATGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145221.2-511s21c1
Sequence:CCGGTGATCATGATGCCGCAATTAACTCGAGTTAATTGCGGCATCATGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145221.2-220s21c1
Sequence:CCGGTCAAGCTATGCATCGGATTTACTCGAGTAAATCCGATGCATAGCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145221.1-363s1c1
Sequence:CCGGGCAGTACTTTCAACTCAACTTCTCGAGAAGTTGAGTTGAAAGTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145221.1-803s1c1
Sequence:CCGGGCAGCAGACAATAGAAGACTTCTCGAGAAGTCTTCTATTGTCTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145221.1-771s1c1
Sequence:CCGGCGAAGAGAAATGGATGGTGATCTCGAGATCACCATCCATTTCTCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145221.1-1765s1c1
Sequence:CCGGCGTGTGTAGTTCTGTATGCTACTCGAGTAGCATACAGAACTACACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173327    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145221.1-2015s1c1
Sequence:CCGGGCTCAGCAAACAGAAACAGATCTCGAGATCTGTTTCTGTTTGCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145221.1-1878s1c1
Sequence:CCGGGAATCAAACAATGAGGGAGAACTCGAGTTCTCCCTCATTGTTTGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012096
VALIDATED
APPL1 MISSION shRNA Bacterial Glycerol Stock
adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000315403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012096.2-235s21c1
Sequence:CCGGGCCACAGCTATTTCCAACTATCTCGAGATAGTTGGAAATAGCTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012096.2-1763s21c1
Sequence:CCGGGTATGACAGAATCGCATTTATCTCGAGATAAATGCGATTCTGTCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012096.2-2219s21c1
Sequence:CCGGGCCAGTCAGAAGAGAGTGATTCTCGAGAATCACTCTCTTCTGACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012096.2-730s21c1
Sequence:CCGGGCATTGTTAGAACCTCTACTTCTCGAGAAGTAGAGGTTCTAACAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350528    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012096.2-2365s21c1
Sequence:CCGGAGGAGGAGATTAAGCTTTATACTCGAGTATAAAGCTTAATCTCCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006299    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_012096.1-3715s1c1
Sequence:CCGGCGGCTGTTTCACACTGTATATCTCGAGATATACAGTGTGAAACAGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012096.1-1576s1c1
Sequence:CCGGCCTTGGTTCAATGGAGGTGAACTCGAGTTCACCTCCATTGAACCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_012096.1-641s1c1
Sequence:CCGGGCATTGTTAGAACCTCTACTTCTCGAGAAGTAGAGGTTCTAACAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_012096.1-2130s1c1
Sequence:CCGGGCCAGTCAGAAGAGAGTGATTCTCGAGAATCACTCTCTTCTGACTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012096
VALIDATED
APPL1 MISSION shRNA shRNA Plasmid DNA
adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000315403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012096.2-235s21c1
Sequence:CCGGGCCACAGCTATTTCCAACTATCTCGAGATAGTTGGAAATAGCTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012096.2-1763s21c1
Sequence:CCGGGTATGACAGAATCGCATTTATCTCGAGATAAATGCGATTCTGTCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012096.2-2219s21c1
Sequence:CCGGGCCAGTCAGAAGAGAGTGATTCTCGAGAATCACTCTCTTCTGACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012096.2-730s21c1
Sequence:CCGGGCATTGTTAGAACCTCTACTTCTCGAGAAGTAGAGGTTCTAACAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350528    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012096.2-2365s21c1
Sequence:CCGGAGGAGGAGATTAAGCTTTATACTCGAGTATAAAGCTTAATCTCCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006299    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_012096.1-3715s1c1
Sequence:CCGGCGGCTGTTTCACACTGTATATCTCGAGATATACAGTGTGAAACAGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012096.1-1576s1c1
Sequence:CCGGCCTTGGTTCAATGGAGGTGAACTCGAGTTCACCTCCATTGAACCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_012096.1-641s1c1
Sequence:CCGGGCATTGTTAGAACCTCTACTTCTCGAGAAGTAGAGGTTCTAACAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_012096.1-2130s1c1
Sequence:CCGGGCCAGTCAGAAGAGAGTGATTCTCGAGAATCACTCTCTTCTGACTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012096
VALIDATED
APPL1 MISSION shRNA Lentiviral Transduction Particles
adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000315403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012096.2-235s21c1
Sequence:CCGGGCCACAGCTATTTCCAACTATCTCGAGATAGTTGGAAATAGCTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012096.2-1763s21c1
Sequence:CCGGGTATGACAGAATCGCATTTATCTCGAGATAAATGCGATTCTGTCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012096.2-2219s21c1
Sequence:CCGGGCCAGTCAGAAGAGAGTGATTCTCGAGAATCACTCTCTTCTGACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012096.2-730s21c1
Sequence:CCGGGCATTGTTAGAACCTCTACTTCTCGAGAAGTAGAGGTTCTAACAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350528    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012096.2-2365s21c1
Sequence:CCGGAGGAGGAGATTAAGCTTTATACTCGAGTATAAAGCTTAATCTCCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006299    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_012096.1-3715s1c1
Sequence:CCGGCGGCTGTTTCACACTGTATATCTCGAGATATACAGTGTGAAACAGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012096.1-1576s1c1
Sequence:CCGGCCTTGGTTCAATGGAGGTGAACTCGAGTTCACCTCCATTGAACCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_012096.1-641s1c1
Sequence:CCGGGCATTGTTAGAACCTCTACTTCTCGAGAAGTAGAGGTTCTAACAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_012096.1-2130s1c1
Sequence:CCGGGCCAGTCAGAAGAGAGTGATTCTCGAGAATCACTCTCTTCTGACTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks