EMAIL THIS PAGE TO A FRIEND

APPL2

adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 2

133 Gene Product Result for
Synonyms: DIP13B
Gene ID:
Human(55198) Summary: The protein encoded by this gene is one of two effectors of the small GTPase RAB5A/Rab5, which are involved in a signal transduction pathway. Both effectors contain an N-terminal Bin/Amphiphysin/Rvs (BAR) domain, a central pleckstrin homology (PH) domain, and a C-terminal phosphotyrosine binding (PTB) domain, and they bind the Rab5 through the BAR domain. They are associated with endosomal membranes and can be translocated to the nucleus in response to the EGF stimulus. They interact with the NuRD/MeCP1 complex (nucleosome remodeling and deacetylase /methyl-CpG-binding protein 1 complex) and are required for efficient cell proliferation. A chromosomal aberration t(12;22)(q24.1;q13.3) involving this gene and the PSAP2 gene results in 22q13.3 deletion syndrome, also known as Phelan-McDermid syndrome. [provided by RefSeq, Oct 2011]
Mouse(216190) adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 2
Rat(362860) adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 2
sheep(101114693) adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 2
domestic guinea pig(100717140) adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 2
naked mole-rat(101696710) adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 2
Zebrafish(100000135) adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 2
chicken(418075) adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 2
domestic cat(101089119) adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 2
cow(515605) adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 2
cow(788375) adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 2-like
dog(481297) adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145220 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145220 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145220 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018171 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018171 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018171 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018171 Rosetta Predictions human pricing
NM_001108741 Rosetta Predictions rat pricing
NM_145220 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018171 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00351425 predicted 969
2 SASI_Hs01_00082010 predicted 589
3 SASI_Hs01_00082011 predicted 865
4 SASI_Hs02_00351426 predicted 689
5 SASI_Hs01_00082012 predicted 550
6 SASI_Hs01_00082014 predicted 1583
7 SASI_Hs01_00082015 predicted 2110
8 SASI_Hs01_00082016 predicted 2098
9 SASI_Hs01_00082017 predicted 492
10 SASI_Hs01_00082018 predicted 1006
11 SASI_Hs01_00082013 predicted 1835
12 SASI_Hs01_00082019 predicted 1751
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108741 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00241625 predicted 493
2 SASI_Rn02_00241626 predicted 1707
3 SASI_Rn02_00241627 predicted 410
4 SASI_Rn02_00241628 predicted 1956
5 SASI_Rn02_00241629 predicted 1279
6 SASI_Rn02_00241630 predicted 607
7 SASI_Rn02_00241631 predicted 418
8 SASI_Rn02_00241632 predicted 914
9 SASI_Rn02_00241633 predicted 1345
10 SASI_Rn02_00241634 predicted 1602
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145220 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00110368 predicted 314
2 SASI_Mm01_00110369 predicted 402
3 SASI_Mm01_00110370 predicted 1443
4 SASI_Mm01_00110371 predicted 1713
5 SASI_Mm02_00340596 predicted 1948
6 SASI_Mm01_00110372 predicted 1174
7 SASI_Mm01_00110373 predicted 415
8 SASI_Mm01_00110374 predicted 1973
9 SASI_Mm01_00110375 predicted 1278
10 SASI_Mm01_00110376 predicted 1693
11 SASI_Mm01_00110377 predicted 1582
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145220
VALIDATED
APPL2 MISSION shRNA Bacterial Glycerol Stock
adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 2
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000182426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_145220.1-532s1c1
Sequence:CCGGGCTCCCTAAGAAGAAGGAGAACTCGAGTTCTCCTTCTTCTTAGGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145220.1-318s1c1
Sequence:CCGGGCGATGAAGAAGTAATTTCAACTCGAGTTGAAATTACTTCTTCATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181227    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145220.1-1391s1c1
Sequence:CCGGCCTGAAACAGAGGAACTGATTCTCGAGAATCAGTTCCTCTGTTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200411    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145220.1-2257s1c1
Sequence:CCGGGCGTGCCTACACTCTACAAATCTCGAGATTTGTAGAGTGTAGGCACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200043    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_145220.1-2714s1c1
Sequence:CCGGCCTTCCTCAAAGGGACCAATTCTCGAGAATTGGTCCCTTTGAGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_145220.1-1552s1c1
Sequence:CCGGGCAGATGTTCATCGTTCGGTTCTCGAGAACCGAACGATGAACATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217861    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145220.2-1699s1c1
Sequence:CCGGGTCAAACTCTGAGGTTGATAGCTCGAGCTATCAACCTCAGAGTTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145220.2-1124s21c1
Sequence:CCGGCAGTGGCAAACCGGGAATAATCTCGAGATTATTCCCGGTTTGCCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145220.2-1943s21c1
Sequence:CCGGAGAAGCACTGGCTCGATTAATCTCGAGATTAATCGAGCCAGTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145220.2-753s21c1
Sequence:CCGGGGCTTCTTGTCATCCGTTAAACTCGAGTTTAACGGATGACAAGAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145220.2-552s21c1
Sequence:CCGGGAGAAGGCGAAGACGGAAATTCTCGAGAATTTCCGTCTTCGCCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375939    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_145220.2-2164s21c1
Sequence:CCGGGAATTTAGAACACCGACAATCCTCGAGGATTGTCGGTGTTCTAAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145220.2-1267s21c1
Sequence:CCGGTTCAGGCGGTGACGCCAATTACTCGAGTAATTGGCGTCACCGCCTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145220
VALIDATED
APPL2 MISSION shRNA shRNA Plasmid DNA
adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 2
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000182426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_145220.1-532s1c1
Sequence:CCGGGCTCCCTAAGAAGAAGGAGAACTCGAGTTCTCCTTCTTCTTAGGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145220.1-318s1c1
Sequence:CCGGGCGATGAAGAAGTAATTTCAACTCGAGTTGAAATTACTTCTTCATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181227    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145220.1-1391s1c1
Sequence:CCGGCCTGAAACAGAGGAACTGATTCTCGAGAATCAGTTCCTCTGTTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200411    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145220.1-2257s1c1
Sequence:CCGGGCGTGCCTACACTCTACAAATCTCGAGATTTGTAGAGTGTAGGCACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200043    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_145220.1-2714s1c1
Sequence:CCGGCCTTCCTCAAAGGGACCAATTCTCGAGAATTGGTCCCTTTGAGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_145220.1-1552s1c1
Sequence:CCGGGCAGATGTTCATCGTTCGGTTCTCGAGAACCGAACGATGAACATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217861    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145220.2-1699s1c1
Sequence:CCGGGTCAAACTCTGAGGTTGATAGCTCGAGCTATCAACCTCAGAGTTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145220.2-1124s21c1
Sequence:CCGGCAGTGGCAAACCGGGAATAATCTCGAGATTATTCCCGGTTTGCCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145220.2-1943s21c1
Sequence:CCGGAGAAGCACTGGCTCGATTAATCTCGAGATTAATCGAGCCAGTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145220.2-753s21c1
Sequence:CCGGGGCTTCTTGTCATCCGTTAAACTCGAGTTTAACGGATGACAAGAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145220.2-552s21c1
Sequence:CCGGGAGAAGGCGAAGACGGAAATTCTCGAGAATTTCCGTCTTCGCCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375939    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_145220.2-2164s21c1
Sequence:CCGGGAATTTAGAACACCGACAATCCTCGAGGATTGTCGGTGTTCTAAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145220.2-1267s21c1
Sequence:CCGGTTCAGGCGGTGACGCCAATTACTCGAGTAATTGGCGTCACCGCCTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145220
VALIDATED
APPL2 MISSION shRNA Lentiviral Transduction Particles
adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 2
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000182426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_145220.1-532s1c1
Sequence:CCGGGCTCCCTAAGAAGAAGGAGAACTCGAGTTCTCCTTCTTCTTAGGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145220.1-318s1c1
Sequence:CCGGGCGATGAAGAAGTAATTTCAACTCGAGTTGAAATTACTTCTTCATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181227    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145220.1-1391s1c1
Sequence:CCGGCCTGAAACAGAGGAACTGATTCTCGAGAATCAGTTCCTCTGTTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200411    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145220.1-2257s1c1
Sequence:CCGGGCGTGCCTACACTCTACAAATCTCGAGATTTGTAGAGTGTAGGCACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200043    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_145220.1-2714s1c1
Sequence:CCGGCCTTCCTCAAAGGGACCAATTCTCGAGAATTGGTCCCTTTGAGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_145220.1-1552s1c1
Sequence:CCGGGCAGATGTTCATCGTTCGGTTCTCGAGAACCGAACGATGAACATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217861    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145220.2-1699s1c1
Sequence:CCGGGTCAAACTCTGAGGTTGATAGCTCGAGCTATCAACCTCAGAGTTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145220.2-1124s21c1
Sequence:CCGGCAGTGGCAAACCGGGAATAATCTCGAGATTATTCCCGGTTTGCCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145220.2-1943s21c1
Sequence:CCGGAGAAGCACTGGCTCGATTAATCTCGAGATTAATCGAGCCAGTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145220.2-753s21c1
Sequence:CCGGGGCTTCTTGTCATCCGTTAAACTCGAGTTTAACGGATGACAAGAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145220.2-552s21c1
Sequence:CCGGGAGAAGGCGAAGACGGAAATTCTCGAGAATTTCCGTCTTCGCCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375939    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_145220.2-2164s21c1
Sequence:CCGGGAATTTAGAACACCGACAATCCTCGAGGATTGTCGGTGTTCTAAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145220.2-1267s21c1
Sequence:CCGGTTCAGGCGGTGACGCCAATTACTCGAGTAATTGGCGTCACCGCCTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018171
APPL2 MISSION shRNA Bacterial Glycerol Stock
adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000155071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018171.2-628s1c1
Sequence:CCGGGCAATGAGCATGACCTCTCAACTCGAGTTGAGAGGTCATGCTCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153500    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018171.2-2396s1c1
Sequence:CCGGCCCACCCATCTACAATGTTATCTCGAGATAACATTGTAGATGGGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154282    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018171.2-2314s1c1
Sequence:CCGGGCTGACAATCGTTTGTGGAATCTCGAGATTCCACAAACGATTGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150613    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018171.2-1978s1c1
Sequence:CCGGGAGAAGAATCTCTGAGTACATCTCGAGATGTACTCAGAGATTCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018171.2-1870s1c1
Sequence:CCGGCTCAAGTATCAAGGGCCAATTCTCGAGAATTGGCCCTTGATACTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018171.2-906s1c1
Sequence:CCGGGCAGACATGGTTCAAAGCATTCTCGAGAATGCTTTGAACCATGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153746    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018171.2-1975s1c1
Sequence:CCGGCTGGAGAAGAATCTCTGAGTACTCGAGTACTCAGAGATTCTTCTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435347    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018171.3-2688s21c1
Sequence:CCGGATCTCATAATTGGACCTAATACTCGAGTATTAGGTCCAATTATGAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018171.3-597s21c1
Sequence:CCGGAGCACTTTAAAGGATCTATTTCTCGAGAAATAGATCCTTTAAAGTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018171.3-2084s21c1
Sequence:CCGGAGAAGCACTGGCTCAATTAATCTCGAGATTAATTGAGCCAGTGCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018171
APPL2 MISSION shRNA shRNA Plasmid DNA
adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000155071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018171.2-628s1c1
Sequence:CCGGGCAATGAGCATGACCTCTCAACTCGAGTTGAGAGGTCATGCTCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153500    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018171.2-2396s1c1
Sequence:CCGGCCCACCCATCTACAATGTTATCTCGAGATAACATTGTAGATGGGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154282    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018171.2-2314s1c1
Sequence:CCGGGCTGACAATCGTTTGTGGAATCTCGAGATTCCACAAACGATTGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150613    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018171.2-1978s1c1
Sequence:CCGGGAGAAGAATCTCTGAGTACATCTCGAGATGTACTCAGAGATTCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018171.2-1870s1c1
Sequence:CCGGCTCAAGTATCAAGGGCCAATTCTCGAGAATTGGCCCTTGATACTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018171.2-906s1c1
Sequence:CCGGGCAGACATGGTTCAAAGCATTCTCGAGAATGCTTTGAACCATGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153746    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018171.2-1975s1c1
Sequence:CCGGCTGGAGAAGAATCTCTGAGTACTCGAGTACTCAGAGATTCTTCTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435347    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018171.3-2688s21c1
Sequence:CCGGATCTCATAATTGGACCTAATACTCGAGTATTAGGTCCAATTATGAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018171.3-597s21c1
Sequence:CCGGAGCACTTTAAAGGATCTATTTCTCGAGAAATAGATCCTTTAAAGTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018171.3-2084s21c1
Sequence:CCGGAGAAGCACTGGCTCAATTAATCTCGAGATTAATTGAGCCAGTGCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018171
APPL2 MISSION shRNA Lentiviral Transduction Particles
adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000155071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018171.2-628s1c1
Sequence:CCGGGCAATGAGCATGACCTCTCAACTCGAGTTGAGAGGTCATGCTCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153500    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018171.2-2396s1c1
Sequence:CCGGCCCACCCATCTACAATGTTATCTCGAGATAACATTGTAGATGGGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154282    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018171.2-2314s1c1
Sequence:CCGGGCTGACAATCGTTTGTGGAATCTCGAGATTCCACAAACGATTGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150613    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018171.2-1978s1c1
Sequence:CCGGGAGAAGAATCTCTGAGTACATCTCGAGATGTACTCAGAGATTCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018171.2-1870s1c1
Sequence:CCGGCTCAAGTATCAAGGGCCAATTCTCGAGAATTGGCCCTTGATACTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018171.2-906s1c1
Sequence:CCGGGCAGACATGGTTCAAAGCATTCTCGAGAATGCTTTGAACCATGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153746    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018171.2-1975s1c1
Sequence:CCGGCTGGAGAAGAATCTCTGAGTACTCGAGTACTCAGAGATTCTTCTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435347    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018171.3-2688s21c1
Sequence:CCGGATCTCATAATTGGACCTAATACTCGAGTATTAGGTCCAATTATGAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018171.3-597s21c1
Sequence:CCGGAGCACTTTAAAGGATCTATTTCTCGAGAAATAGATCCTTTAAAGTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018171.3-2084s21c1
Sequence:CCGGAGAAGCACTGGCTCAATTAATCTCGAGATTAATTGAGCCAGTGCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks