EMAIL THIS PAGE TO A FRIEND

APRT

adenine phosphoribosyltransferase

65 Gene Product Result for
Synonyms: AMP APRTD
UniProtKB ID: P07741, G5E9J2, Q3KP55, Q68DF9
Gene ID:
Human(353) Summary: Adenine phosphoribosyltransferase belongs to the purine/pyrimidine phosphoribosyltransferase family. A conserved feature of this gene is the distribution of CpG dinucleotides. This enzyme catalyzes the formation of AMP and inorganic pyrophosphate from adenine and 5-phosphoribosyl-1-pyrophosphate (PRPP). It also produces adenine as a by-product of the polyamine biosynthesis pathway. A homozygous deficiency in this enzyme causes 2,8-dihydroxyadenine urolithiasis. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(11821) adenine phosphoribosyl transferase
Rat(292072) adenine phosphoribosyl transferase
Zebrafish(393641) adenine phosphoribosyl transferase
chicken(100857155) adenine phosphoribosyltransferase
dog(479615) adenine phosphoribosyltransferase
domestic cat(101098913) adenine phosphoribosyltransferase
cow(519017) adenine phosphoribosyltransferase
fruit fly(48224) Adenine phosphoribosyltransferase
domestic guinea pig(100731502) adenine phosphoribosyltransferase
naked mole-rat(101713665) adenine phosphoribosyltransferase
sheep(101108335) adenine phosphoribosyltransferase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009698 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009698 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009698 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000485 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000485 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000485 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000485 Rosetta Predictions human pricing
NM_001030018 Rosetta Predictions human pricing
NM_001013061 Rosetta Predictions rat pricing
NM_009698 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000485 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00048010 predicted 315
2 SASI_Hs01_00048011 predicted 222
3 SASI_Hs01_00048013 predicted 575
4 SASI_Hs01_00048014 predicted 330
5 SASI_Hs01_00048015 predicted 528
6 SASI_Hs01_00048016 predicted 278
7 SASI_Hs01_00048017 predicted 418
8 SASI_Hs01_00048018 predicted 213
9 SASI_Hs01_00048019 predicted 326
10 SASI_Hs02_00302636 predicted 418
11 SASI_Hs01_00048012 predicted 587
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001030018 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00216047 predicted 310
2 SASI_Hs01_00216048 predicted 222
3 SASI_Hs02_00307631 predicted 327
4 SASI_Hs01_00216050 predicted 275
5 SASI_Hs01_00216051 predicted 422
6 SASI_Hs01_00216052 predicted 221
7 SASI_Hs01_00216053 predicted 267
8 SASI_Hs01_00216054 predicted 391
9 SASI_Hs02_00307632 predicted 326
10 SASI_Hs01_00216056 predicted 205
11 SASI_Hs01_00216049 predicted 456
12 SASI_Hs01_00216055 predicted 420
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013061 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00030141 predicted 294
2 SASI_Rn01_00030142 predicted 244
3 SASI_Rn01_00030143 predicted 276
4 SASI_Rn01_00030144 predicted 288
5 SASI_Rn01_00030145 predicted 290
6 SASI_Rn01_00030146 predicted 290
7 SASI_Rn01_00030147 predicted 201
8 SASI_Rn01_00030148 predicted 282
9 SASI_Rn01_00030149 predicted 214
10 SASI_Rn01_00030150 predicted 205
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009698 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00029570 predicted 573
2 SASI_Mm02_00316820 predicted 353
3 SASI_Mm01_00029572 predicted 567
4 SASI_Mm02_00316821 predicted 364
5 SASI_Mm02_00316822 predicted 274
6 SASI_Mm02_00316823 predicted 275
7 SASI_Mm02_00316824 predicted 371
8 SASI_Mm01_00029573 predicted 244
9 SASI_Mm01_00029574 predicted 320
10 SASI_Mm01_00029575 predicted 572
11 SASI_Mm01_00029571 predicted 275
12 SASI_Mm01_00029576 predicted 563
13 SASI_Mm01_00029577 predicted 372
14 SASI_Mm01_00029578 predicted 474
15 SASI_Mm01_00029579 predicted 473
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009698
VALIDATED
APRT MISSION shRNA Bacterial Glycerol Stock
adenine phosphoribosyltransferase
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000331414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009698.2-359s21c1
Sequence:CCGGCCACTGTGTCAGCCTCCTATTCTCGAGAATAGGAGGCTGACACAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009698.2-576s21c1
Sequence:CCGGGCTAGGACCTATACCATTCTTCTCGAGAAGAATGGTATAGGTCCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009698.2-167s21c1
Sequence:CCGGCCCTCTTGAAAGACCCGGACTCTCGAGAGTCCGGGTCTTTCAAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009698.2-436s21c1
Sequence:CCGGCAGAGAGTGGTCATTGTGGATCTCGAGATCCACAATGACCACTCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009698.2-247s21c1
Sequence:CCGGATCGACTACATCGCAGGTCTACTCGAGTAGACCTGCGATGTAGTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009698.1-529s1c1
Sequence:CCGGGCTAGGACCTATACCATTCTTCTCGAGAAGAATGGTATAGGTCCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055147    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009698.1-200s1c1
Sequence:CCGGATCGACTACATCGCAGGTCTACTCGAGTAGACCTGCGATGTAGTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009698.1-389s1c1
Sequence:CCGGCAGAGAGTGGTCATTGTGGATCTCGAGATCCACAATGACCACTCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009698.1-120s1c1
Sequence:CCGGCCCTCTTGAAAGACCCGGACTCTCGAGAGTCCGGGTCTTTCAAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009698.1-312s1c1
Sequence:CCGGCCACTGTGTCAGCCTCCTATTCTCGAGAATAGGAGGCTGACACAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009698
VALIDATED
APRT MISSION shRNA shRNA Plasmid DNA
adenine phosphoribosyltransferase
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000331414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009698.2-359s21c1
Sequence:CCGGCCACTGTGTCAGCCTCCTATTCTCGAGAATAGGAGGCTGACACAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009698.2-576s21c1
Sequence:CCGGGCTAGGACCTATACCATTCTTCTCGAGAAGAATGGTATAGGTCCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009698.2-167s21c1
Sequence:CCGGCCCTCTTGAAAGACCCGGACTCTCGAGAGTCCGGGTCTTTCAAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009698.2-436s21c1
Sequence:CCGGCAGAGAGTGGTCATTGTGGATCTCGAGATCCACAATGACCACTCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009698.2-247s21c1
Sequence:CCGGATCGACTACATCGCAGGTCTACTCGAGTAGACCTGCGATGTAGTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009698.1-529s1c1
Sequence:CCGGGCTAGGACCTATACCATTCTTCTCGAGAAGAATGGTATAGGTCCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055147    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009698.1-200s1c1
Sequence:CCGGATCGACTACATCGCAGGTCTACTCGAGTAGACCTGCGATGTAGTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009698.1-389s1c1
Sequence:CCGGCAGAGAGTGGTCATTGTGGATCTCGAGATCCACAATGACCACTCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009698.1-120s1c1
Sequence:CCGGCCCTCTTGAAAGACCCGGACTCTCGAGAGTCCGGGTCTTTCAAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009698.1-312s1c1
Sequence:CCGGCCACTGTGTCAGCCTCCTATTCTCGAGAATAGGAGGCTGACACAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009698
VALIDATED
APRT MISSION shRNA Lentiviral Transduction Particles
adenine phosphoribosyltransferase
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000331414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009698.2-359s21c1
Sequence:CCGGCCACTGTGTCAGCCTCCTATTCTCGAGAATAGGAGGCTGACACAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009698.2-576s21c1
Sequence:CCGGGCTAGGACCTATACCATTCTTCTCGAGAAGAATGGTATAGGTCCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009698.2-167s21c1
Sequence:CCGGCCCTCTTGAAAGACCCGGACTCTCGAGAGTCCGGGTCTTTCAAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009698.2-436s21c1
Sequence:CCGGCAGAGAGTGGTCATTGTGGATCTCGAGATCCACAATGACCACTCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009698.2-247s21c1
Sequence:CCGGATCGACTACATCGCAGGTCTACTCGAGTAGACCTGCGATGTAGTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009698.1-529s1c1
Sequence:CCGGGCTAGGACCTATACCATTCTTCTCGAGAAGAATGGTATAGGTCCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055147    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009698.1-200s1c1
Sequence:CCGGATCGACTACATCGCAGGTCTACTCGAGTAGACCTGCGATGTAGTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009698.1-389s1c1
Sequence:CCGGCAGAGAGTGGTCATTGTGGATCTCGAGATCCACAATGACCACTCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009698.1-120s1c1
Sequence:CCGGCCCTCTTGAAAGACCCGGACTCTCGAGAGTCCGGGTCTTTCAAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009698.1-312s1c1
Sequence:CCGGCCACTGTGTCAGCCTCCTATTCTCGAGAATAGGAGGCTGACACAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000485
VALIDATED
APRT MISSION shRNA Bacterial Glycerol Stock
adenine phosphoribosyltransferase
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000035014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000485.1-393s1c1
Sequence:CCGGGCTGAGCTGGAGATTCAGAAACTCGAGTTTCTGAATCTCCAGCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035018    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_000485.1-551s1c1
Sequence:CCGGCTCGCTTAAGGGCAGGGAGAACTCGAGTTCTCCCTGCCCTTAAGCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000485.1-355s1c1
Sequence:CCGGCCACTCTGTGGGCCTCCTATTCTCGAGAATAGGAGGCCCACAGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000485.1-137s1c1
Sequence:CCGGAGGCGTGGTATTCAGGGACATCTCGAGATGTCCCTGAATACCACGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000485.1-572s1c1
Sequence:CCGGGCTGGCACCTGTACCCTTCTTCTCGAGAAGAAGGGTACAGGTGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000485
VALIDATED
APRT MISSION shRNA shRNA Plasmid DNA
adenine phosphoribosyltransferase
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000035014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000485.1-393s1c1
Sequence:CCGGGCTGAGCTGGAGATTCAGAAACTCGAGTTTCTGAATCTCCAGCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035018    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_000485.1-551s1c1
Sequence:CCGGCTCGCTTAAGGGCAGGGAGAACTCGAGTTCTCCCTGCCCTTAAGCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000485.1-355s1c1
Sequence:CCGGCCACTCTGTGGGCCTCCTATTCTCGAGAATAGGAGGCCCACAGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000485.1-137s1c1
Sequence:CCGGAGGCGTGGTATTCAGGGACATCTCGAGATGTCCCTGAATACCACGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000485.1-572s1c1
Sequence:CCGGGCTGGCACCTGTACCCTTCTTCTCGAGAAGAAGGGTACAGGTGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000485
VALIDATED
APRT MISSION shRNA Lentiviral Transduction Particles
adenine phosphoribosyltransferase
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000035014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000485.1-393s1c1
Sequence:CCGGGCTGAGCTGGAGATTCAGAAACTCGAGTTTCTGAATCTCCAGCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035018    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_000485.1-551s1c1
Sequence:CCGGCTCGCTTAAGGGCAGGGAGAACTCGAGTTCTCCCTGCCCTTAAGCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000485.1-355s1c1
Sequence:CCGGCCACTCTGTGGGCCTCCTATTCTCGAGAATAGGAGGCCCACAGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000485.1-137s1c1
Sequence:CCGGAGGCGTGGTATTCAGGGACATCTCGAGATGTCCCTGAATACCACGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000485.1-572s1c1
Sequence:CCGGGCTGGCACCTGTACCCTTCTTCTCGAGAAGAAGGGTACAGGTGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks