EMAIL THIS PAGE TO A FRIEND

APTX

aprataxin

Synonyms: AOA AOA1 AXA1 EAOH EOAHA FHA-HIT
Gene ID:
Human(54840) Summary: This gene encodes a member of the histidine triad (HIT) superfamily. The encoded protein may play a role in single-stranded DNA repair through its nucleotide-binding activity and its diadenosine polyphosphate hydrolase activity. Mutations in this gene have been associated with ataxia-ocular apraxia. Alternatively spliced transcript variants have been identified for this gene.[provided by RefSeq, Aug 2010]
Mouse(66408) aprataxin
Rat(259271) aprataxin
Zebrafish(405797) aprataxin
cow(359714) aprataxin
Horse(100068091) aprataxin
dog(442943) aprataxin
chicken(395173) aprataxin
Thale Cress(830940) adenylylsulfate sulfohydrolase
sheep(101105385) aprataxin
180 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025545 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025545 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025545 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_017692 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017692 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017692 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017692 Rosetta Predictions human pricing
NM_175069 Rosetta Predictions human pricing
NM_175071 Rosetta Predictions human pricing
NM_175072 Rosetta Predictions human pricing
NM_175073 Rosetta Predictions human pricing
NM_148889 Rosetta Predictions rat pricing
NM_001025444 Rosetta Predictions mouse pricing
NM_001025445 Rosetta Predictions mouse pricing
NM_025545 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017692 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00177907 predicted 1376
2 SASI_Hs02_00350444 predicted 1510
3 SASI_Hs01_00177908 predicted 1172
4 SASI_Hs01_00177909 predicted 1431
5 SASI_Hs02_00350445 predicted 1398
6 SASI_Hs01_00177910 predicted 1275
7 SASI_Hs01_00177911 predicted 1250
8 SASI_Hs01_00177912 predicted 1425
9 SASI_Hs01_00177913 predicted 1367
10 SASI_Hs01_00177914 predicted 1598
11 SASI_Hs01_00177915 predicted 645
12 SASI_Hs01_00177916 predicted 1399
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175069 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00135123 predicted 1396
2 SASI_Hs01_00135124 predicted 1193
3 SASI_Hs01_00135125 predicted 1421
4 SASI_Hs01_00135126 predicted 1291
5 SASI_Hs01_00135127 predicted 1271
6 SASI_Hs01_00135128 predicted 556
7 SASI_Hs01_00135129 predicted 1443
8 SASI_Hs01_00135130 predicted 1383
9 SASI_Hs01_00135131 predicted 1253
10 SASI_Hs02_00368979 predicted 1314
11 SASI_Hs01_00135132 predicted 626
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175071 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00076622 predicted 1194
2 SASI_Hs02_00368980 predicted 1336
3 SASI_Hs01_00076623 predicted 993
4 SASI_Hs01_00076624 predicted 1251
5 SASI_Hs02_00368981 predicted 1221
6 SASI_Hs01_00076625 predicted 1088
7 SASI_Hs01_00076626 predicted 1071
8 SASI_Hs01_00076627 predicted 1246
9 SASI_Hs01_00076628 predicted 1180
10 SASI_Hs01_00076629 predicted 1416
11 SASI_Hs01_00076630 predicted 462
12 SASI_Hs01_00076631 predicted 1222
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175072 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00192324 predicted 1404
2 SASI_Hs01_00192325 predicted 1197
3 SASI_Hs01_00192326 predicted 1462
4 SASI_Hs02_00368982 predicted 1425
5 SASI_Hs01_00192327 predicted 1299
6 SASI_Hs01_00192328 predicted 1272
7 SASI_Hs01_00192329 predicted 606
8 SASI_Hs01_00192330 predicted 1443
9 SASI_Hs01_00192331 predicted 1389
10 SASI_Hs01_00192332 predicted 1627
11 SASI_Hs01_00192333 predicted 675
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175073 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00167506 predicted 1445
2 SASI_Hs01_00167507 predicted 1243
3 SASI_Hs01_00167508 predicted 1500
4 SASI_Hs02_00368983 predicted 1464
5 SASI_Hs01_00167509 predicted 1344
6 SASI_Hs01_00167510 predicted 1322
7 SASI_Hs01_00167511 predicted 651
8 SASI_Hs01_00167512 predicted 1493
9 SASI_Hs01_00167513 predicted 1429
10 SASI_Hs02_00368984 predicted 1672
11 SASI_Hs01_00167514 predicted 714
12 SASI_Hs01_00167515 predicted 1472
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_148889 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00083902 predicted 391
2 SASI_Rn01_00083903 predicted 448
3 SASI_Rn01_00083904 predicted 787
4 SASI_Rn01_00083905 predicted 573
5 SASI_Rn01_00083906 predicted 479
6 SASI_Rn01_00083907 predicted 588
7 SASI_Rn01_00083908 predicted 416
8 SASI_Rn01_00083909 predicted 613
9 SASI_Rn01_00083910 predicted 1057
10 SASI_Rn01_00083911 predicted 1166
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025444 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00287884 predicted 538
2 SASI_Mm01_00173136 predicted 1113
3 SASI_Mm01_00173137 predicted 1145
4 SASI_Mm01_00173139 predicted 962
5 SASI_Mm01_00173142 predicted 686
6 SASI_Mm01_00173143 predicted 516
7 SASI_Mm01_00173145 predicted 816
8 SASI_Mm02_00287885 predicted 1158
9 SASI_Mm02_00287886 predicted 1105
10 SASI_Mm02_00287887 predicted 392
11 SASI_Mm01_00173138 predicted 1353
12 SASI_Mm01_00173140 predicted 1325
13 SASI_Mm01_00173141 predicted 498
14 SASI_Mm01_00173144 predicted 409
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025445 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00129706 predicted 1118
2 SASI_Mm01_00129707 predicted 1144
3 SASI_Mm01_00129708 predicted 1345
4 SASI_Mm01_00129709 predicted 962
5 SASI_Mm01_00129710 predicted 1323
6 SASI_Mm01_00129711 predicted 498
7 SASI_Mm01_00129712 predicted 679
8 SASI_Mm01_00129713 predicted 514
9 SASI_Mm01_00129714 predicted 401
10 SASI_Mm01_00129715 predicted 815
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025545 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00328484 predicted 686
2 SASI_Mm01_00189209 predicted 1262
3 SASI_Mm01_00189210 predicted 1280
4 SASI_Mm01_00189212 predicted 1096
5 SASI_Mm01_00189215 predicted 823
6 SASI_Mm01_00189216 predicted 656
7 SASI_Mm01_00189218 predicted 957
8 SASI_Mm02_00328485 predicted 1297
9 SASI_Mm02_00328486 predicted 1255
10 SASI_Mm02_00328487 predicted 530
11 SASI_Mm01_00189211 predicted 1491
12 SASI_Mm01_00189213 predicted 1470
13 SASI_Mm01_00189214 predicted 646
14 SASI_Mm01_00189217 predicted 550
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025545
VALIDATED
APTX MISSION shRNA Bacterial Glycerol Stock
aprataxin
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000193867    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025545.2-1285s1c1
Sequence:CCGGCGTACACTTCTTCGAAACAAACTCGAGTTTGTTTCGAAGAAGTGTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025545.2-348s1c1
Sequence:CCGGGTGTAACAAGGGATATGTCAACTCGAGTTGACATATCCCTTGTTACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173662    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025545.2-1273s1c1
Sequence:CCGGCCTGAACTAAAGCGTACACTTCTCGAGAAGTGTACGCTTTAGTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025545.2-951s1c1
Sequence:CCGGCCACGTACATCTTCATGTGATCTCGAGATCACATGAAGATGTACGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025545.2-683s1c1
Sequence:CCGGGTCAAGGCTTGAAGATGTCTACTCGAGTAGACATCTTCAAGCCTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216145    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025545.4-839s1c1
Sequence:CCGGCCTTGAACTTCTCAAACATATCTCGAGATATGTTTGAGAAGTTCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216785    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025545.4-872s1c1
Sequence:CCGGGGAGAAGGTGATAGCAGATTTCTCGAGAAATCTGCTATCACCTTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217012    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025545.4-458s1c1
Sequence:CCGGCCACATGGTGAATGGACTTTACTCGAGTAAAGTCCATTCACCATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025545
VALIDATED
APTX MISSION shRNA shRNA Plasmid DNA
aprataxin
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000193867    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025545.2-1285s1c1
Sequence:CCGGCGTACACTTCTTCGAAACAAACTCGAGTTTGTTTCGAAGAAGTGTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025545.2-348s1c1
Sequence:CCGGGTGTAACAAGGGATATGTCAACTCGAGTTGACATATCCCTTGTTACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173662    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025545.2-1273s1c1
Sequence:CCGGCCTGAACTAAAGCGTACACTTCTCGAGAAGTGTACGCTTTAGTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025545.2-951s1c1
Sequence:CCGGCCACGTACATCTTCATGTGATCTCGAGATCACATGAAGATGTACGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025545.2-683s1c1
Sequence:CCGGGTCAAGGCTTGAAGATGTCTACTCGAGTAGACATCTTCAAGCCTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216145    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025545.4-839s1c1
Sequence:CCGGCCTTGAACTTCTCAAACATATCTCGAGATATGTTTGAGAAGTTCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216785    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025545.4-872s1c1
Sequence:CCGGGGAGAAGGTGATAGCAGATTTCTCGAGAAATCTGCTATCACCTTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217012    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025545.4-458s1c1
Sequence:CCGGCCACATGGTGAATGGACTTTACTCGAGTAAAGTCCATTCACCATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025545
VALIDATED
APTX MISSION shRNA Lentiviral Transduction Particles
aprataxin
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000193867    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025545.2-1285s1c1
Sequence:CCGGCGTACACTTCTTCGAAACAAACTCGAGTTTGTTTCGAAGAAGTGTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025545.2-348s1c1
Sequence:CCGGGTGTAACAAGGGATATGTCAACTCGAGTTGACATATCCCTTGTTACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173662    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025545.2-1273s1c1
Sequence:CCGGCCTGAACTAAAGCGTACACTTCTCGAGAAGTGTACGCTTTAGTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025545.2-951s1c1
Sequence:CCGGCCACGTACATCTTCATGTGATCTCGAGATCACATGAAGATGTACGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025545.2-683s1c1
Sequence:CCGGGTCAAGGCTTGAAGATGTCTACTCGAGTAGACATCTTCAAGCCTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216145    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025545.4-839s1c1
Sequence:CCGGCCTTGAACTTCTCAAACATATCTCGAGATATGTTTGAGAAGTTCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216785    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025545.4-872s1c1
Sequence:CCGGGGAGAAGGTGATAGCAGATTTCTCGAGAAATCTGCTATCACCTTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217012    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025545.4-458s1c1
Sequence:CCGGCCACATGGTGAATGGACTTTACTCGAGTAAAGTCCATTCACCATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017692
VALIDATED
APTX MISSION shRNA Bacterial Glycerol Stock
aprataxin
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000083638    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_017692.2-1438s1c1
Sequence:CCGGGCTGGTTATACATTTCTGTTTCTCGAGAAACAGAAATGTATAACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017692.2-842s1c1
Sequence:CCGGCCGAGTATGAGCCATGTACATCTCGAGATGTACATGGCTCATACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_017692.2-644s1c1
Sequence:CCGGGTGGTGGTGATAAAGGATAAACTCGAGTTTATCCTTTATCACCACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_017692.2-956s1c1
Sequence:CCGGGCTGTGATCGAGATGGTACAACTCGAGTTGTACCATCTCGATCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_017692.2-677s1c1
Sequence:CCGGCGTTACCATTGGCTGGTCTTACTCGAGTAAGACCAGCCAATGGTAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_017692.2-737s21c1
Sequence:CCGGGAACACCTTGAACTCCTTAAGCTCGAGCTTAAGGAGTTCAAGGTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294490    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_017692.2-1182s21c1
Sequence:CCGGCTTGTGAACTTCTACTCATTTCTCGAGAAATGAGTAGAAGTTCACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_017692.2-644s21c1
Sequence:CCGGGTGGTGGTGATAAAGGATAAACTCGAGTTTATCCTTTATCACCACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017692.2-884s21c1
Sequence:CCGGTTTGATTCTCCTTGCCTTAAACTCGAGTTTAAGGCAAGGAGAATCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017692
VALIDATED
APTX MISSION shRNA shRNA Plasmid DNA
aprataxin
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000083638    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_017692.2-1438s1c1
Sequence:CCGGGCTGGTTATACATTTCTGTTTCTCGAGAAACAGAAATGTATAACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017692.2-842s1c1
Sequence:CCGGCCGAGTATGAGCCATGTACATCTCGAGATGTACATGGCTCATACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_017692.2-644s1c1
Sequence:CCGGGTGGTGGTGATAAAGGATAAACTCGAGTTTATCCTTTATCACCACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_017692.2-956s1c1
Sequence:CCGGGCTGTGATCGAGATGGTACAACTCGAGTTGTACCATCTCGATCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_017692.2-677s1c1
Sequence:CCGGCGTTACCATTGGCTGGTCTTACTCGAGTAAGACCAGCCAATGGTAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_017692.2-737s21c1
Sequence:CCGGGAACACCTTGAACTCCTTAAGCTCGAGCTTAAGGAGTTCAAGGTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294490    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_017692.2-1182s21c1
Sequence:CCGGCTTGTGAACTTCTACTCATTTCTCGAGAAATGAGTAGAAGTTCACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_017692.2-644s21c1
Sequence:CCGGGTGGTGGTGATAAAGGATAAACTCGAGTTTATCCTTTATCACCACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017692.2-884s21c1
Sequence:CCGGTTTGATTCTCCTTGCCTTAAACTCGAGTTTAAGGCAAGGAGAATCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017692
VALIDATED
APTX MISSION shRNA Lentiviral Transduction Particles
aprataxin
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000083638    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_017692.2-1438s1c1
Sequence:CCGGGCTGGTTATACATTTCTGTTTCTCGAGAAACAGAAATGTATAACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017692.2-842s1c1
Sequence:CCGGCCGAGTATGAGCCATGTACATCTCGAGATGTACATGGCTCATACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_017692.2-644s1c1
Sequence:CCGGGTGGTGGTGATAAAGGATAAACTCGAGTTTATCCTTTATCACCACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_017692.2-956s1c1
Sequence:CCGGGCTGTGATCGAGATGGTACAACTCGAGTTGTACCATCTCGATCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_017692.2-677s1c1
Sequence:CCGGCGTTACCATTGGCTGGTCTTACTCGAGTAAGACCAGCCAATGGTAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_017692.2-737s21c1
Sequence:CCGGGAACACCTTGAACTCCTTAAGCTCGAGCTTAAGGAGTTCAAGGTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294490    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_017692.2-1182s21c1
Sequence:CCGGCTTGTGAACTTCTACTCATTTCTCGAGAAATGAGTAGAAGTTCACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_017692.2-644s21c1
Sequence:CCGGGTGGTGGTGATAAAGGATAAACTCGAGTTTATCCTTTATCACCACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017692.2-884s21c1
Sequence:CCGGTTTGATTCTCCTTGCCTTAAACTCGAGTTTAAGGCAAGGAGAATCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks