EMAIL THIS PAGE TO A FRIEND

AQP10

aquaporin 10

24 Gene Product Result for
Synonyms: AQPA_HUMAN
UniProtKB ID: Q96PS8, Q5VYD3, Q5VYD4, Q8NG70
Gene ID:
Human(89872) Summary: This gene encodes a member of the aquaglyceroporin family of integral membrane proteins. Members of this family function as water-permeable channels in the epithelia of organs that absorb and excrete water. This protein was shown to function as a water-selective channel, and could also permeate neutral solutes such as glycerol and urea. [provided by RefSeq, Jul 2008]
sheep(101102866) aquaporin 10
chicken(101668462) aquaporin 10
chicken(101749384) aquaporin 10
cow(785782) aquaporin 10
dog(612280) aquaporin 10
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_080429 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_080429 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_080429 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU065251 MISSION® esiRNA esiRNA human AQP10 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_080429 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080429 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00362269 predicted 867
2 SASI_Hs01_00139283 predicted 656
3 SASI_Hs01_00139284 predicted 225
4 SASI_Hs01_00139285 predicted 935
5 SASI_Hs01_00139286 predicted 863
6 SASI_Hs01_00139287 predicted 1077
7 SASI_Hs01_00139289 predicted 382
8 SASI_Hs01_00139290 predicted 636
9 SASI_Hs01_00139291 predicted 350
10 SASI_Hs01_00139292 predicted 1084
11 SASI_Hs01_00139288 predicted 918
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080429
AQP10 MISSION shRNA Bacterial Glycerol Stock
aquaporin 10
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000060198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080429.2-389s1c1
Sequence:CCGGGCCACCTATGTTCTCTACCATCTCGAGATGGTAGAGAACATAGGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080429.2-494s1c1
Sequence:CCGGCCCTATCTGTCCCTGAACAATCTCGAGATTGTTCAGGGACAGATAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080429.2-418s1c1
Sequence:CCGGACAGAACTATACAGGTGGGAACTCGAGTTCCCACCTGTATAGTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080429.2-800s21c1
Sequence:CCGGACCGTTGGCACAGCCACTTACCTCGAGGTAAGTGGCTGTGCCAACGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080429.2-198s21c1
Sequence:CCGGGCAACTTCTTCACCATGTTTCCTCGAGGAAACATGGTGAAGAAGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080429.2-873s21c1
Sequence:CCGGTGGTGTCTGCTCAACACAAAGCTCGAGCTTTGTGTTGAGCAGACACCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080429
AQP10 MISSION shRNA shRNA Plasmid DNA
aquaporin 10
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000060198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080429.2-389s1c1
Sequence:CCGGGCCACCTATGTTCTCTACCATCTCGAGATGGTAGAGAACATAGGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080429.2-494s1c1
Sequence:CCGGCCCTATCTGTCCCTGAACAATCTCGAGATTGTTCAGGGACAGATAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080429.2-418s1c1
Sequence:CCGGACAGAACTATACAGGTGGGAACTCGAGTTCCCACCTGTATAGTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080429.2-800s21c1
Sequence:CCGGACCGTTGGCACAGCCACTTACCTCGAGGTAAGTGGCTGTGCCAACGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080429.2-198s21c1
Sequence:CCGGGCAACTTCTTCACCATGTTTCCTCGAGGAAACATGGTGAAGAAGTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080429.2-873s21c1
Sequence:CCGGTGGTGTCTGCTCAACACAAAGCTCGAGCTTTGTGTTGAGCAGACACCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080429
AQP10 MISSION shRNA Lentiviral Transduction Particles
aquaporin 10
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000060198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080429.2-389s1c1
Sequence:CCGGGCCACCTATGTTCTCTACCATCTCGAGATGGTAGAGAACATAGGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080429.2-494s1c1
Sequence:CCGGCCCTATCTGTCCCTGAACAATCTCGAGATTGTTCAGGGACAGATAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080429.2-418s1c1
Sequence:CCGGACAGAACTATACAGGTGGGAACTCGAGTTCCCACCTGTATAGTTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080429.2-800s21c1
Sequence:CCGGACCGTTGGCACAGCCACTTACCTCGAGGTAAGTGGCTGTGCCAACGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080429.2-198s21c1
Sequence:CCGGGCAACTTCTTCACCATGTTTCCTCGAGGAAACATGGTGAAGAAGTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080429.2-873s21c1
Sequence:CCGGTGGTGTCTGCTCAACACAAAGCTCGAGCTTTGTGTTGAGCAGACACCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)