EMAIL THIS PAGE TO A FRIEND

AQP11

aquaporin 11

82 Gene Product Result for
Synonyms: AQPX1
UniProtKB ID: Q8NBQ7
Gene ID:
Mouse(66333) aquaporin 11
Rat(286758) aquaporin 11
Zebrafish(553476) aquaporin 11
chicken(426725) aquaporin 11
cow(510038) aquaporin 11
dog(476798) aquaporin 11
sheep(101111499) aquaporin 11
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173039 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173039 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173039 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175105 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175105 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175105 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173039 Rosetta Predictions human pricing
NM_173105 Rosetta Predictions rat pricing
NM_175105 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173039 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00016346 predicted 798
2 SASI_Hs02_00368037 predicted 806
3 SASI_Hs01_00016347 predicted 709
4 SASI_Hs01_00016348 predicted 980
5 SASI_Hs01_00016349 predicted 780
6 SASI_Hs01_00016350 predicted 1008
7 SASI_Hs01_00016351 predicted 1015
8 SASI_Hs01_00016352 predicted 916
9 SASI_Hs01_00016353 predicted 599
10 SASI_Hs01_00016354 predicted 721
11 SASI_Hs01_00016345 predicted 1092
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173105 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00038070 predicted 898
2 SASI_Rn01_00038071 predicted 404
3 SASI_Rn01_00038072 predicted 604
4 SASI_Rn01_00038073 predicted 694
5 SASI_Rn01_00038074 predicted 1059
6 SASI_Rn01_00038075 predicted 957
7 SASI_Rn01_00038076 predicted 709
8 SASI_Rn01_00038077 predicted 905
9 SASI_Rn01_00038078 predicted 963
10 SASI_Rn01_00038079 predicted 698
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175105 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00181065 predicted 941
2 SASI_Mm01_00181066 predicted 1090
3 SASI_Mm01_00181068 predicted 1078
4 SASI_Mm01_00181069 predicted 680
5 SASI_Mm01_00181070 predicted 698
6 SASI_Mm01_00181071 predicted 722
7 SASI_Mm01_00181072 predicted 935
8 SASI_Mm01_00181073 predicted 879
9 SASI_Mm02_00345705 predicted 909
10 SASI_Mm02_00345706 predicted 682
11 SASI_Mm01_00181067 predicted 1048
12 SASI_Mm01_00181074 predicted 980
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173039
VALIDATED
AQP11 MISSION shRNA Bacterial Glycerol Stock
aquaporin 11
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000427848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173039.1-834s21c1
Sequence:CCGGTCCGAGTCGACTTGCTCAAAGCTCGAGCTTTGAGCAAGTCGACTCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173039.1-917s21c1
Sequence:CCGGGTCCGAACCAAGCTTCGTATCCTCGAGGATACGAAGCTTGGTTCGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173039.1-1141s21c1
Sequence:CCGGGCATAACAACCATACAATTAACTCGAGTTAATTGTATGGTTGTTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173039.1-601s21c1
Sequence:CCGGCGTCTACTTCTTCTCGCTTGTCTCGAGACAAGCGAGAAGAAGTAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416597    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173039.1-1181s21c1
Sequence:CCGGCAAAGACTCAGACTAACATACCTCGAGGTATGTTAGTCTGAGTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173039.1-719s21c1
Sequence:CCGGCTATTGGCTCAGCTGGTTAGTCTCGAGACTAACCAGCTGAGCCAATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005249    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_173039.1-1285s1c1
Sequence:CCGGCCTTTGAGGAAGCTGCCTTATCTCGAGATAAGGCAGCTTCCTCAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005253    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_173039.1-502s1c1
Sequence:CCGGCCTGGAGTTTCTAGCCACCTTCTCGAGAAGGTGGCTAGAAACTCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_173039.1-981s1c1
Sequence:CCGGGAAGTCTAACAGGAGCTGTATCTCGAGATACAGCTCCTGTTAGACTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173039.1-1078s1c1
Sequence:CCGGGCTGGCTCCTTCTTTAGGTATCTCGAGATACCTAAAGAAGGAGCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_173039.1-1010s1c1
Sequence:CCGGGCTTTGGCACTTTCGCTACATCTCGAGATGTAGCGAAAGTGCCAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173039
VALIDATED
AQP11 MISSION shRNA shRNA Plasmid DNA
aquaporin 11
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000427848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173039.1-834s21c1
Sequence:CCGGTCCGAGTCGACTTGCTCAAAGCTCGAGCTTTGAGCAAGTCGACTCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173039.1-917s21c1
Sequence:CCGGGTCCGAACCAAGCTTCGTATCCTCGAGGATACGAAGCTTGGTTCGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173039.1-1141s21c1
Sequence:CCGGGCATAACAACCATACAATTAACTCGAGTTAATTGTATGGTTGTTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173039.1-601s21c1
Sequence:CCGGCGTCTACTTCTTCTCGCTTGTCTCGAGACAAGCGAGAAGAAGTAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416597    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173039.1-1181s21c1
Sequence:CCGGCAAAGACTCAGACTAACATACCTCGAGGTATGTTAGTCTGAGTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173039.1-719s21c1
Sequence:CCGGCTATTGGCTCAGCTGGTTAGTCTCGAGACTAACCAGCTGAGCCAATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005249    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_173039.1-1285s1c1
Sequence:CCGGCCTTTGAGGAAGCTGCCTTATCTCGAGATAAGGCAGCTTCCTCAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005253    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_173039.1-502s1c1
Sequence:CCGGCCTGGAGTTTCTAGCCACCTTCTCGAGAAGGTGGCTAGAAACTCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_173039.1-981s1c1
Sequence:CCGGGAAGTCTAACAGGAGCTGTATCTCGAGATACAGCTCCTGTTAGACTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173039.1-1078s1c1
Sequence:CCGGGCTGGCTCCTTCTTTAGGTATCTCGAGATACCTAAAGAAGGAGCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_173039.1-1010s1c1
Sequence:CCGGGCTTTGGCACTTTCGCTACATCTCGAGATGTAGCGAAAGTGCCAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173039
VALIDATED
AQP11 MISSION shRNA Lentiviral Transduction Particles
aquaporin 11
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000427848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173039.1-834s21c1
Sequence:CCGGTCCGAGTCGACTTGCTCAAAGCTCGAGCTTTGAGCAAGTCGACTCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173039.1-917s21c1
Sequence:CCGGGTCCGAACCAAGCTTCGTATCCTCGAGGATACGAAGCTTGGTTCGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173039.1-1141s21c1
Sequence:CCGGGCATAACAACCATACAATTAACTCGAGTTAATTGTATGGTTGTTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173039.1-601s21c1
Sequence:CCGGCGTCTACTTCTTCTCGCTTGTCTCGAGACAAGCGAGAAGAAGTAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416597    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173039.1-1181s21c1
Sequence:CCGGCAAAGACTCAGACTAACATACCTCGAGGTATGTTAGTCTGAGTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173039.1-719s21c1
Sequence:CCGGCTATTGGCTCAGCTGGTTAGTCTCGAGACTAACCAGCTGAGCCAATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005249    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_173039.1-1285s1c1
Sequence:CCGGCCTTTGAGGAAGCTGCCTTATCTCGAGATAAGGCAGCTTCCTCAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005253    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_173039.1-502s1c1
Sequence:CCGGCCTGGAGTTTCTAGCCACCTTCTCGAGAAGGTGGCTAGAAACTCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_173039.1-981s1c1
Sequence:CCGGGAAGTCTAACAGGAGCTGTATCTCGAGATACAGCTCCTGTTAGACTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173039.1-1078s1c1
Sequence:CCGGGCTGGCTCCTTCTTTAGGTATCTCGAGATACCTAAAGAAGGAGCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_173039.1-1010s1c1
Sequence:CCGGGCTTTGGCACTTTCGCTACATCTCGAGATGTAGCGAAAGTGCCAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175105
AQP11 MISSION shRNA Bacterial Glycerol Stock
aquaporin 11
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000173829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175105.2-758s1c1
Sequence:CCGGCGATCATCATAGAGGCCATCTCTCGAGAGATGGCCTCTATGATGATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175105.2-692s1c1
Sequence:CCGGCCAAGTACCATTACGACGAAACTCGAGTTTCGTCGTAATGGTACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175105.2-1002s1c1
Sequence:CCGGGCTGATGATGATCCTCATGTTCTCGAGAACATGAGGATCATCATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175105.2-941s1c1
Sequence:CCGGGCTTTGACGAACTCTTCTATACTCGAGTATAGAAGAGTTCGTCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175105
AQP11 MISSION shRNA shRNA Plasmid DNA
aquaporin 11
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000173829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175105.2-758s1c1
Sequence:CCGGCGATCATCATAGAGGCCATCTCTCGAGAGATGGCCTCTATGATGATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175105.2-692s1c1
Sequence:CCGGCCAAGTACCATTACGACGAAACTCGAGTTTCGTCGTAATGGTACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175105.2-1002s1c1
Sequence:CCGGGCTGATGATGATCCTCATGTTCTCGAGAACATGAGGATCATCATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175105.2-941s1c1
Sequence:CCGGGCTTTGACGAACTCTTCTATACTCGAGTATAGAAGAGTTCGTCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175105
AQP11 MISSION shRNA Lentiviral Transduction Particles
aquaporin 11
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000173829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175105.2-758s1c1
Sequence:CCGGCGATCATCATAGAGGCCATCTCTCGAGAGATGGCCTCTATGATGATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175105.2-692s1c1
Sequence:CCGGCCAAGTACCATTACGACGAAACTCGAGTTTCGTCGTAATGGTACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175105.2-1002s1c1
Sequence:CCGGGCTGATGATGATCCTCATGTTCTCGAGAACATGAGGATCATCATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175105.2-941s1c1
Sequence:CCGGGCTTTGACGAACTCTTCTATACTCGAGTATAGAAGAGTTCGTCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks