EMAIL THIS PAGE TO A FRIEND

AQP12A

aquaporin 12A

65 Gene Product Result for
Synonyms: AQP-12 AQP12 AQPX2
UniProtKB ID: Q8IXF9
Gene ID:
Rat(367316) aquaporin 12A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198998 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198998 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198998 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198998 Rosetta Predictions human pricing
NM_001109009 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198998 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00022884 predicted 309
2 SASI_Hs01_00022885 predicted 811
3 SASI_Hs01_00022886 predicted 812
4 SASI_Hs01_00022887 predicted 710
5 SASI_Hs01_00022888 predicted 706
6 SASI_Hs01_00022890 predicted 573
7 SASI_Hs01_00022891 predicted 703
8 SASI_Hs01_00022892 predicted 810
9 SASI_Hs02_00372513 predicted 683
10 SASI_Hs02_00372514 predicted 817
11 SASI_Hs01_00022889 predicted 352
12 SASI_Hs01_00022893 predicted 680
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109009 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00244274 predicted 756
2 SASI_Rn02_00244275 predicted 671
3 SASI_Rn02_00244276 predicted 500
4 SASI_Rn02_00244277 predicted 472
5 SASI_Rn02_00244278 predicted 788
6 SASI_Rn02_00244279 predicted 676
7 SASI_Rn02_00244280 predicted 731
8 SASI_Rn02_00244281 predicted 672
9 SASI_Rn02_00244282 predicted 658
10 SASI_Rn02_00244283 predicted 724
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198998
AQP12A MISSION shRNA Bacterial Glycerol Stock
aquaporin 12A
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198998.1-547s21c1
Sequence:CCGGTGTTTCCATCTGACCCTCCTGCTCGAGCAGGAGGGTCAGATGGAAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198998.1-815s21c1
Sequence:CCGGACCTGTTCTACGGCCAGAAGACTCGAGTCTTCTGGCCGTAGAACAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198998.1-354s21c1
Sequence:CCGGTCTGCCTGGCACGCTGTTGAACTCGAGTTCAACAGCGTGCCAGGCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198998.1-332s21c1
Sequence:CCGGAGTTCCTCATGGCCGAGCAGTCTCGAGACTGCTCGGCCATGAGGAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198998.1-804s21c1
Sequence:CCGGTTTCCAGAGGAACCTGTTCTACTCGAGTAGAACAGGTTCCTCTGGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198998.1-829s1c1
Sequence:CCGGCAGAAGAACAAGTACCGAGCACTCGAGTGCTCGGTACTTGTTCTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198998.1-647s1c1
Sequence:CCGGCCTTCACGTCTGCCTTCTTCACTCGAGTGAAGAAGGCAGACGTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198998.1-708s1c1
Sequence:CCGGACACACCTTACTGGAGTACGTCTCGAGACGTACTCCAGTAAGGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198998.1-410s1c1
Sequence:CCGGGCACCCTGATGCGCCTCTGCTCTCGAGAGCAGAGGCGCATCAGGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198998.1-105s1c1
Sequence:CCGGTGCCACCTTCGCCCTCTGTGACTCGAGTCACAGAGGGCGAAGGTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198998
AQP12A MISSION shRNA shRNA Plasmid DNA
aquaporin 12A
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198998.1-547s21c1
Sequence:CCGGTGTTTCCATCTGACCCTCCTGCTCGAGCAGGAGGGTCAGATGGAAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198998.1-815s21c1
Sequence:CCGGACCTGTTCTACGGCCAGAAGACTCGAGTCTTCTGGCCGTAGAACAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198998.1-354s21c1
Sequence:CCGGTCTGCCTGGCACGCTGTTGAACTCGAGTTCAACAGCGTGCCAGGCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198998.1-332s21c1
Sequence:CCGGAGTTCCTCATGGCCGAGCAGTCTCGAGACTGCTCGGCCATGAGGAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198998.1-804s21c1
Sequence:CCGGTTTCCAGAGGAACCTGTTCTACTCGAGTAGAACAGGTTCCTCTGGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198998.1-829s1c1
Sequence:CCGGCAGAAGAACAAGTACCGAGCACTCGAGTGCTCGGTACTTGTTCTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198998.1-647s1c1
Sequence:CCGGCCTTCACGTCTGCCTTCTTCACTCGAGTGAAGAAGGCAGACGTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198998.1-708s1c1
Sequence:CCGGACACACCTTACTGGAGTACGTCTCGAGACGTACTCCAGTAAGGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198998.1-410s1c1
Sequence:CCGGGCACCCTGATGCGCCTCTGCTCTCGAGAGCAGAGGCGCATCAGGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198998.1-105s1c1
Sequence:CCGGTGCCACCTTCGCCCTCTGTGACTCGAGTCACAGAGGGCGAAGGTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198998
AQP12A MISSION shRNA Lentiviral Transduction Particles
aquaporin 12A
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198998.1-547s21c1
Sequence:CCGGTGTTTCCATCTGACCCTCCTGCTCGAGCAGGAGGGTCAGATGGAAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198998.1-815s21c1
Sequence:CCGGACCTGTTCTACGGCCAGAAGACTCGAGTCTTCTGGCCGTAGAACAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198998.1-354s21c1
Sequence:CCGGTCTGCCTGGCACGCTGTTGAACTCGAGTTCAACAGCGTGCCAGGCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198998.1-332s21c1
Sequence:CCGGAGTTCCTCATGGCCGAGCAGTCTCGAGACTGCTCGGCCATGAGGAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198998.1-804s21c1
Sequence:CCGGTTTCCAGAGGAACCTGTTCTACTCGAGTAGAACAGGTTCCTCTGGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198998.1-829s1c1
Sequence:CCGGCAGAAGAACAAGTACCGAGCACTCGAGTGCTCGGTACTTGTTCTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198998.1-647s1c1
Sequence:CCGGCCTTCACGTCTGCCTTCTTCACTCGAGTGAAGAAGGCAGACGTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198998.1-708s1c1
Sequence:CCGGACACACCTTACTGGAGTACGTCTCGAGACGTACTCCAGTAAGGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198998.1-410s1c1
Sequence:CCGGGCACCCTGATGCGCCTCTGCTCTCGAGAGCAGAGGCGCATCAGGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198998.1-105s1c1
Sequence:CCGGTGCCACCTTCGCCCTCTGTGACTCGAGTCACAGAGGGCGAAGGTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks