EMAIL THIS PAGE TO A FRIEND

AQP12B

aquaporin 12B

23 Gene Product Result for
Synonyms: INSSA3
UniProtKB ID: A6NM10, A4QPB9
Gene ID:
cow(616625) aquaporin 12B
domestic cat(101095121) aquaporin 12B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301067 ANTI-AQP12B (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
flow cytometry, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001102467 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001102467 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001102467 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001102467 Rosetta Predictions human pricing
XM_927405 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001102467 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00323183 predicted 844
2 SASI_Hs02_00323184 predicted 842
3 SASI_Hs02_00323185 predicted 734
4 SASI_Hs02_00323186 predicted 730
5 SASI_Hs02_00323187 predicted 604
6 SASI_Hs02_00323188 predicted 733
7 SASI_Hs02_00323189 predicted 836
8 SASI_Hs02_00323190 predicted 712
9 SASI_Hs02_00323191 predicted 848
10 SASI_Hs02_00323192 predicted 675
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_927405 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00263186 predicted 814
2 SASI_Hs01_00263187 predicted 808
3 SASI_Hs01_00263188 predicted 708
4 SASI_Hs01_00263189 predicted 696
5 SASI_Hs01_00263190 predicted 575
6 SASI_Hs01_00263191 predicted 695
7 SASI_Hs01_00263192 predicted 801
8 SASI_Hs01_00263193 predicted 680
9 SASI_Hs01_00263194 predicted 683
10 SASI_Hs01_00263195 predicted 814
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001102467
AQP12B MISSION shRNA Bacterial Glycerol Stock
aquaporin 12B
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102467.1-843s21c1
Sequence:CCGGGAACCTGTTCTACGGCCAGAACTCGAGTTCTGGCCGTAGAACAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102467.1-90s21c1
Sequence:CCGGCTTCTTCTTTGCCACCTTCACCTCGAGGTGAAGGTGGCAAAGAAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102467.1-854s21c1
Sequence:CCGGACGGCCAGAAGAACAAGTACCCTCGAGGGTACTTGTTCTTCTGGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102467.1-739s21c1
Sequence:CCGGCACACCTTACTGGAGTACGTGCTCGAGCACGTACTCCAGTAAGGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102467.1-679s21c1
Sequence:CCGGTTCACGTCTGCCTTCTTCAACCTCGAGGTTGAAGAAGGCAGACGTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001102467
AQP12B MISSION shRNA shRNA Plasmid DNA
aquaporin 12B
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102467.1-843s21c1
Sequence:CCGGGAACCTGTTCTACGGCCAGAACTCGAGTTCTGGCCGTAGAACAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102467.1-90s21c1
Sequence:CCGGCTTCTTCTTTGCCACCTTCACCTCGAGGTGAAGGTGGCAAAGAAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102467.1-854s21c1
Sequence:CCGGACGGCCAGAAGAACAAGTACCCTCGAGGGTACTTGTTCTTCTGGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102467.1-739s21c1
Sequence:CCGGCACACCTTACTGGAGTACGTGCTCGAGCACGTACTCCAGTAAGGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102467.1-679s21c1
Sequence:CCGGTTCACGTCTGCCTTCTTCAACCTCGAGGTTGAAGAAGGCAGACGTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001102467
AQP12B MISSION shRNA Lentiviral Transduction Particles
aquaporin 12B
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102467.1-843s21c1
Sequence:CCGGGAACCTGTTCTACGGCCAGAACTCGAGTTCTGGCCGTAGAACAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102467.1-90s21c1
Sequence:CCGGCTTCTTCTTTGCCACCTTCACCTCGAGGTGAAGGTGGCAAAGAAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102467.1-854s21c1
Sequence:CCGGACGGCCAGAAGAACAAGTACCCTCGAGGGTACTTGTTCTTCTGGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102467.1-739s21c1
Sequence:CCGGCACACCTTACTGGAGTACGTGCTCGAGCACGTACTCCAGTAAGGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102467.1-679s21c1
Sequence:CCGGTTCACGTCTGCCTTCTTCAACCTCGAGGTTGAAGAAGGCAGACGTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks