EMAIL THIS PAGE TO A FRIEND

AQP1

aquaporin 1

123 Gene Product Result for
Synonyms: AQP-CHIP CHIP28 CO
Gene ID:
Human(358) Summary: Aquaporins are a family of small integral membrane proteins related to the major intrinsic protein (MIP or AQP0). This gene encodes an aquaporin which functions as a molecular water channel protein. It is a homotetramer with 6 bilayer spanning domains and N-glycosylation sites. The protein physically resembles channel proteins and is abundant in erythrocytes and renal tubes. The gene encoding this aquaporin is a possible candidate for disorders involving imbalance in ocular fluid movement. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2010]
Mouse(11826) aquaporin 1
Rat(25240) aquaporin 1
chicken(420384) aquaporin 1 (Colton blood group)
domestic cat(101087725) aquaporin 1 (Colton blood group)
cow(282653) aquaporin 1 (Colton blood group)
dog(403732) aquaporin 1 (Colton blood group)
sheep(442999) aquaporin 1 (Colton blood group)
Domestic Rabbit(100008839) aquaporin 1 (Colton blood group)
domestic guinea pig(100715876) aquaporin 1 (Colton blood group)
naked mole-rat(101712783) aquaporin 1 (Colton blood group)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000385 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000385 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000385 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007472 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007472 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007472 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198098 Rosetta Predictions human pricing
NM_012778 Rosetta Predictions rat pricing
NM_007472 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198098 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00139363 predicted 586
2 SASI_Hs02_00371650 predicted 1229
3 SASI_Hs01_00139364 predicted 270
4 SASI_Hs02_00371651 predicted 302
5 SASI_Hs01_00139365 predicted 1240
6 SASI_Hs01_00139366 predicted 1229
7 SASI_Hs01_00139367 predicted 409
8 SASI_Hs01_00139369 predicted 649
9 SASI_Hs01_00139370 predicted 245
10 SASI_Hs01_00139372 predicted 604
11 SASI_Hs01_00139368 predicted 283
12 SASI_Hs01_00139371 predicted 419
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012778 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00260180 predicted 778
2 SASI_Rn01_00052451 predicted 1091
3 SASI_Rn01_00052452 predicted 1300
4 SASI_Rn01_00052453 predicted 806
5 SASI_Rn01_00052454 predicted 1193
6 SASI_Rn01_00052455 predicted 849
7 SASI_Rn02_00260181 predicted 663
8 SASI_Rn01_00052456 predicted 757
9 SASI_Rn01_00052457 predicted 469
10 SASI_Rn01_00052459 predicted 952
11 SASI_Rn01_00052450 predicted 936
12 SASI_Rn01_00052458 predicted 1360
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007472 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00037884 predicted 1227
2 SASI_Mm02_00311701 predicted 1144
3 SASI_Mm02_00311702 predicted 1329
4 SASI_Mm01_00037887 predicted 977
5 SASI_Mm01_00037889 predicted 390
6 SASI_Mm02_00311703 predicted 545
7 SASI_Mm02_00311704 predicted 1082
8 SASI_Mm02_00311705 predicted 1356
9 SASI_Mm02_00311706 predicted 1230
10 SASI_Mm02_00311707 predicted 357
11 SASI_Mm01_00037882 predicted 413
12 SASI_Mm01_00037883 predicted 732
13 SASI_Mm01_00037885 predicted 598
14 SASI_Mm01_00037886 predicted 1362
15 SASI_Mm01_00037888 predicted 671
16 SASI_Mm01_00037890 predicted 665
17 SASI_Mm01_00037891 predicted 1270
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000385
AQP1 MISSION shRNA Bacterial Glycerol Stock
aquaporin 1
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000044128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000385.3-660s1c1
Sequence:CCGGGATCACACACAACTTCAGCAACTCGAGTTGCTGAAGTTGTGTGTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000385.3-117s1c1
Sequence:CCGGCACGACCCTCTTTGTCTTCATCTCGAGATGAAGACAAAGAGGGTCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000385.3-726s1c1
Sequence:CCGGTGTACTCATCTACGACTTCATCTCGAGATGAAGTCGTAGATGAGTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000385
AQP1 MISSION shRNA shRNA Plasmid DNA
aquaporin 1
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000044128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000385.3-660s1c1
Sequence:CCGGGATCACACACAACTTCAGCAACTCGAGTTGCTGAAGTTGTGTGTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000385.3-117s1c1
Sequence:CCGGCACGACCCTCTTTGTCTTCATCTCGAGATGAAGACAAAGAGGGTCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000385.3-726s1c1
Sequence:CCGGTGTACTCATCTACGACTTCATCTCGAGATGAAGTCGTAGATGAGTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000385
AQP1 MISSION shRNA Lentiviral Transduction Particles
aquaporin 1
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000044128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000385.3-660s1c1
Sequence:CCGGGATCACACACAACTTCAGCAACTCGAGTTGCTGAAGTTGTGTGTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000385.3-117s1c1
Sequence:CCGGCACGACCCTCTTTGTCTTCATCTCGAGATGAAGACAAAGAGGGTCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000385.3-726s1c1
Sequence:CCGGTGTACTCATCTACGACTTCATCTCGAGATGAAGTCGTAGATGAGTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007472
VALIDATED
AQP1 MISSION shRNA Bacterial Glycerol Stock
aquaporin 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000119602    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007472.1-2184s1c1
Sequence:CCGGGCCACATTCTTCAGGTGCTTACTCGAGTAAGCACCTGAAGAATGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007472.1-223s1c1
Sequence:CCGGCCTTTGGTTTGAGCATCGCTACTCGAGTAGCGATGCTCAAACCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007472.1-420s1c1
Sequence:CCGGGACAATTCACTTGGCCGCAATCTCGAGATTGCGGCCAAGTGAATTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007472.1-720s1c1
Sequence:CCGGGCCCTGGCAGTGCTCATCTATCTCGAGATAGATGAGCACTGCCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007472.1-671s1c1
Sequence:CCGGCAACTTCTCAAACCACTGGATCTCGAGATCCAGTGGTTTGAGAAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007472
VALIDATED
AQP1 MISSION shRNA shRNA Plasmid DNA
aquaporin 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000119602    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007472.1-2184s1c1
Sequence:CCGGGCCACATTCTTCAGGTGCTTACTCGAGTAAGCACCTGAAGAATGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007472.1-223s1c1
Sequence:CCGGCCTTTGGTTTGAGCATCGCTACTCGAGTAGCGATGCTCAAACCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007472.1-420s1c1
Sequence:CCGGGACAATTCACTTGGCCGCAATCTCGAGATTGCGGCCAAGTGAATTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007472.1-720s1c1
Sequence:CCGGGCCCTGGCAGTGCTCATCTATCTCGAGATAGATGAGCACTGCCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007472.1-671s1c1
Sequence:CCGGCAACTTCTCAAACCACTGGATCTCGAGATCCAGTGGTTTGAGAAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007472
VALIDATED
AQP1 MISSION shRNA Lentiviral Transduction Particles
aquaporin 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000119602    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007472.1-2184s1c1
Sequence:CCGGGCCACATTCTTCAGGTGCTTACTCGAGTAAGCACCTGAAGAATGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007472.1-223s1c1
Sequence:CCGGCCTTTGGTTTGAGCATCGCTACTCGAGTAGCGATGCTCAAACCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007472.1-420s1c1
Sequence:CCGGGACAATTCACTTGGCCGCAATCTCGAGATTGCGGCCAAGTGAATTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007472.1-720s1c1
Sequence:CCGGGCCCTGGCAGTGCTCATCTATCTCGAGATAGATGAGCACTGCCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007472.1-671s1c1
Sequence:CCGGCAACTTCTCAAACCACTGGATCTCGAGATCCAGTGGTTTGAGAAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks