EMAIL THIS PAGE TO A FRIEND

AQP2

aquaporin 2 (collecting duct)

150 Gene Product Result for
Synonyms: AQP-CD WCH-CD
UniProtKB ID: P41181, Q9UD68
Gene ID:
Human(359) Summary: This gene encodes a water channel protein located in the kidney collecting tubule. It belongs to the MIP/aquaporin family, some members of which are clustered together on chromosome 12q13. Mutations in this gene have been linked to autosomal dominant and recessive forms of nephrogenic diabetes insipidus. [provided by RefSeq, Oct 2008]
Mouse(11827) aquaporin 2
Rat(25386) aquaporin 2 (collecting duct)
chicken(431304) aquaporin 2 (collecting duct)
dog(486552) aquaporin 2 (collecting duct)
Horse(100059758) aquaporin 2 (collecting duct)
cow(539870) aquaporin 2 (collecting duct)
domestic cat(101092948) aquaporin 2 (collecting duct)
domestic guinea pig(100722014) aquaporin 2 (collecting duct)
naked mole-rat(101706579) aquaporin 2 (collecting duct)
sheep(443024) aquaporin 2 (collecting duct)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000486 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000486 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000486 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009699 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009699 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009699 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000486 Rosetta Predictions human pricing
NM_012909 Rosetta Predictions rat pricing
NM_009699 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000486 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00082530 predicted 560
2 SASI_Hs01_00082531 predicted 1363
3 SASI_Hs01_00082532 predicted 429
4 SASI_Hs01_00082533 predicted 744
5 SASI_Hs01_00082534 predicted 815
6 SASI_Hs01_00082535 predicted 1267
7 SASI_Hs01_00082536 predicted 751
8 SASI_Hs01_00082537 predicted 1369
9 SASI_Hs02_00302637 predicted 328
10 SASI_Hs02_00302638 predicted 233
11 SASI_Hs01_00082528 predicted 1273
12 SASI_Hs01_00082529 predicted 656
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012909 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00057380 predicted 383
2 SASI_Rn01_00057381 predicted 664
3 SASI_Rn01_00057382 predicted 392
4 SASI_Rn01_00057383 predicted 425
5 SASI_Rn01_00057384 predicted 242
6 SASI_Rn01_00057385 predicted 328
7 SASI_Rn01_00057386 predicted 390
8 SASI_Rn01_00057387 predicted 507
9 SASI_Rn01_00057388 predicted 465
10 SASI_Rn01_00057389 predicted 1033
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009699 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00316825 predicted 534
2 SASI_Mm01_00157468 predicted 520
3 SASI_Mm01_00157464 predicted 569
4 SASI_Mm01_00157466 predicted 677
5 SASI_Mm02_00316826 predicted 731
6 SASI_Mm01_00157469 predicted 284
7 SASI_Mm01_00157470 predicted 821
8 SASI_Mm01_00157471 predicted 287
9 SASI_Mm01_00157472 predicted 282
10 SASI_Mm02_00316827 predicted 516
11 SASI_Mm01_00157465 predicted 526
12 SASI_Mm01_00157467 predicted 224
13 SASI_Mm01_00157473 predicted 231
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000486
AQP2 MISSION shRNA Bacterial Glycerol Stock
aquaporin 2 (collecting duct)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000425989    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000486.5-1153s21c1
Sequence:CCGGTTCAGGGAACTGGGAACTTAGCTCGAGCTAAGTTCCCAGTTCCCTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000486.5-604s21c1
Sequence:CCGGCACCTCCTTGGGATCCATTACCTCGAGGTAATGGATCCCAAGGAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000486.3-760s1c1
Sequence:CCGGGCCAGCCAAGAGCCTGTCGGACTCGAGTCCGACAGGCTCTTGGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000486.3-737s1c1
Sequence:CCGGCTCTACAACTACGTGCTGTTTCTCGAGAAACAGCACGTAGTTGTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000486.3-658s1c1
Sequence:CCGGAGCTGTCGTCACTGGCAAATTCTCGAGAATTTGCCAGTGACGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000486.3-220s1c1
Sequence:CCGGCATGGCGTTTGGCTTGGGTATCTCGAGATACCCAAGCCAAACGCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000486.3-209s1c1
Sequence:CCGGCTACAGATTGCCATGGCGTTTCTCGAGAAACGCCATGGCAATCTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000486
AQP2 MISSION shRNA shRNA Plasmid DNA
aquaporin 2 (collecting duct)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000425989    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000486.5-1153s21c1
Sequence:CCGGTTCAGGGAACTGGGAACTTAGCTCGAGCTAAGTTCCCAGTTCCCTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000486.5-604s21c1
Sequence:CCGGCACCTCCTTGGGATCCATTACCTCGAGGTAATGGATCCCAAGGAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000486.3-760s1c1
Sequence:CCGGGCCAGCCAAGAGCCTGTCGGACTCGAGTCCGACAGGCTCTTGGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000486.3-737s1c1
Sequence:CCGGCTCTACAACTACGTGCTGTTTCTCGAGAAACAGCACGTAGTTGTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000486.3-658s1c1
Sequence:CCGGAGCTGTCGTCACTGGCAAATTCTCGAGAATTTGCCAGTGACGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000486.3-220s1c1
Sequence:CCGGCATGGCGTTTGGCTTGGGTATCTCGAGATACCCAAGCCAAACGCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000486.3-209s1c1
Sequence:CCGGCTACAGATTGCCATGGCGTTTCTCGAGAAACGCCATGGCAATCTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000486
AQP2 MISSION shRNA Lentiviral Transduction Particles
aquaporin 2 (collecting duct)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000425989    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000486.5-1153s21c1
Sequence:CCGGTTCAGGGAACTGGGAACTTAGCTCGAGCTAAGTTCCCAGTTCCCTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000486.5-604s21c1
Sequence:CCGGCACCTCCTTGGGATCCATTACCTCGAGGTAATGGATCCCAAGGAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000486.3-760s1c1
Sequence:CCGGGCCAGCCAAGAGCCTGTCGGACTCGAGTCCGACAGGCTCTTGGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000486.3-737s1c1
Sequence:CCGGCTCTACAACTACGTGCTGTTTCTCGAGAAACAGCACGTAGTTGTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000486.3-658s1c1
Sequence:CCGGAGCTGTCGTCACTGGCAAATTCTCGAGAATTTGCCAGTGACGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000486.3-220s1c1
Sequence:CCGGCATGGCGTTTGGCTTGGGTATCTCGAGATACCCAAGCCAAACGCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000486.3-209s1c1
Sequence:CCGGCTACAGATTGCCATGGCGTTTCTCGAGAAACGCCATGGCAATCTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009699
AQP2 MISSION shRNA Bacterial Glycerol Stock
aquaporin 2 (collecting duct)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000105525    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009699.2-1210s1c1
Sequence:CCGGCTGTGGTTAGTGCATCTAATTCTCGAGAATTAGATGCACTAACCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009699.2-655s1c1
Sequence:CCGGGCAGTTGTCACTGGCAAGTTTCTCGAGAAACTTGCCAGTGACAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009699.2-192s1c1
Sequence:CCGGCCCACCCTCTGTGCTCCAGATCTCGAGATCTGGAGCACAGAGGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009699.2-536s1c1
Sequence:CCGGGCCGCAGTGACAACCTGGGTACTCGAGTACCCAGGTTGTCACTGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009699.2-732s1c1
Sequence:CCGGCCTCTACAACTACCTGCTGTTCTCGAGAACAGCAGGTAGTTGTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009699
AQP2 MISSION shRNA shRNA Plasmid DNA
aquaporin 2 (collecting duct)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000105525    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009699.2-1210s1c1
Sequence:CCGGCTGTGGTTAGTGCATCTAATTCTCGAGAATTAGATGCACTAACCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009699.2-655s1c1
Sequence:CCGGGCAGTTGTCACTGGCAAGTTTCTCGAGAAACTTGCCAGTGACAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009699.2-192s1c1
Sequence:CCGGCCCACCCTCTGTGCTCCAGATCTCGAGATCTGGAGCACAGAGGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009699.2-536s1c1
Sequence:CCGGGCCGCAGTGACAACCTGGGTACTCGAGTACCCAGGTTGTCACTGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009699.2-732s1c1
Sequence:CCGGCCTCTACAACTACCTGCTGTTCTCGAGAACAGCAGGTAGTTGTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009699
AQP2 MISSION shRNA Lentiviral Transduction Particles
aquaporin 2 (collecting duct)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000105525    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009699.2-1210s1c1
Sequence:CCGGCTGTGGTTAGTGCATCTAATTCTCGAGAATTAGATGCACTAACCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009699.2-655s1c1
Sequence:CCGGGCAGTTGTCACTGGCAAGTTTCTCGAGAAACTTGCCAGTGACAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009699.2-192s1c1
Sequence:CCGGCCCACCCTCTGTGCTCCAGATCTCGAGATCTGGAGCACAGAGGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009699.2-536s1c1
Sequence:CCGGGCCGCAGTGACAACCTGGGTACTCGAGTACCCAGGTTGTCACTGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009699.2-732s1c1
Sequence:CCGGCCTCTACAACTACCTGCTGTTCTCGAGAACAGCAGGTAGTTGTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks