EMAIL THIS PAGE TO A FRIEND

AQP3

aquaporin 3 (Gill blood group)

147 Gene Product Result for
Synonyms: AQP-3 GIL
Gene ID:
Human(360) Summary: This gene encodes the water channel protein aquaporin 3. Aquaporins are a family of small integral membrane proteins related to the major intrinsic protein, also known as aquaporin 0. Aquaporin 3 is localized at the basal lateral membranes of collecting duct cells in the kidney. In addition to its water channel function, aquaporin 3 has been found to facilitate the transport of nonionic small solutes such as urea and glycerol, but to a smaller degree. It has been suggested that water channels can be functionally heterogeneous and possess water and solute permeation mechanisms. [provided by RefSeq, Aug 2011]
Mouse(11828) aquaporin 3
Rat(65133) aquaporin 3
sheep(443047) aquaporin 3 (Gill blood group)
naked mole-rat(101725963) aquaporin 3 (Gill blood group)
domestic guinea pig(100723824) aquaporin 3 (Gill blood group)
chicken(426894) aquaporin 3 (Gill blood group)
dog(611792) aquaporin 3 (Gill blood group)
Horse(100053851) aquaporin 3 (Gill blood group)
cow(780866) aquaporin 3 (Gill blood group)
domestic cat(101101676) aquaporin 3 (Gill blood group)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016689 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016689 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016689 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004925 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004925 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004925 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004925 Rosetta Predictions human pricing
NM_031703 Rosetta Predictions rat pricing
NM_016689 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004925 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00170323 predicted 929
2 SASI_Hs01_00170324 predicted 415
3 SASI_Hs01_00170325 predicted 345
4 SASI_Hs01_00170326 predicted 375
5 SASI_Hs01_00170327 predicted 974
6 SASI_Hs01_00170328 predicted 365
7 SASI_Hs01_00170329 predicted 392
8 SASI_Hs01_00170330 predicted 818
9 SASI_Hs01_00170332 predicted 918
10 SASI_Hs02_00338591 predicted 515
11 SASI_Hs01_00170331 predicted 901
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031703 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00265060 predicted 276
2 SASI_Rn01_00108356 predicted 498
3 SASI_Rn01_00108358 predicted 709
4 SASI_Rn01_00108359 predicted 579
5 SASI_Rn01_00108360 predicted 464
6 SASI_Rn01_00108361 predicted 604
7 SASI_Rn01_00108362 predicted 723
8 SASI_Rn01_00108363 predicted 320
9 SASI_Rn01_00108364 predicted 271
10 SASI_Rn01_00108365 predicted 717
11 SASI_Rn01_00108357 predicted 659
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016689 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00028931 predicted 704
2 SASI_Mm01_00028932 predicted 512
3 SASI_Mm01_00028933 predicted 357
4 SASI_Mm01_00028934 predicted 448
5 SASI_Mm01_00028936 predicted 453
6 SASI_Mm01_00028938 predicted 376
7 SASI_Mm01_00028939 predicted 600
8 SASI_Mm02_00323347 predicted 840
9 SASI_Mm02_00323348 predicted 435
10 SASI_Mm02_00323349 predicted 451
11 SASI_Mm01_00028930 predicted 275
12 SASI_Mm01_00028935 predicted 904
13 SASI_Mm01_00028937 predicted 788
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016689
AQP3 MISSION shRNA Bacterial Glycerol Stock
aquaporin 3 (Gill blood group)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000102168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016689.1-498s1c1
Sequence:CCGGAGCTGGAATCTTTGCCACCTACTCGAGTAGGTGGCAAAGATTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102165    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016689.1-1494s1c1
Sequence:CCGGGCTGTGTAATATGTTTCTGTTCTCGAGAACAGAAACATATTACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016689.1-429s1c1
Sequence:CCGGTGGGCTGTACTACGATGCAATCTCGAGATTGCATCGTAGTACAGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016689.1-681s1c1
Sequence:CCGGCATGGGCTTCAATTCTGGCTACTCGAGTAGCCAGAATTGAAGCCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016689.1-455s1c1
Sequence:CCGGCCTTTGCCAACAATGAGCTTTCTCGAGAAAGCTCATTGTTGGCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000439981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016689.2-603s21c1
Sequence:CCGGGCCATCGTTGACCCTTATAACCTCGAGGTTATAAGGGTCAACGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415505    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016689.2-1037s21c1
Sequence:CCGGTGATGCCTCTCTCGGGCTAAACTCGAGTTTAGCCCGAGAGAGGCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426908    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016689.2-1150s21c1
Sequence:CCGGCAAGGTAGGATAGCAAATAAGCTCGAGCTTATTTGCTATCCTACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016689.2-836s21c1
Sequence:CCGGCATCGCTGGTGTCTTCGTGTACTCGAGTACACGAAGACACCAGCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016689
AQP3 MISSION shRNA shRNA Plasmid DNA
aquaporin 3 (Gill blood group)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000102168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016689.1-498s1c1
Sequence:CCGGAGCTGGAATCTTTGCCACCTACTCGAGTAGGTGGCAAAGATTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102165    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016689.1-1494s1c1
Sequence:CCGGGCTGTGTAATATGTTTCTGTTCTCGAGAACAGAAACATATTACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016689.1-429s1c1
Sequence:CCGGTGGGCTGTACTACGATGCAATCTCGAGATTGCATCGTAGTACAGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016689.1-681s1c1
Sequence:CCGGCATGGGCTTCAATTCTGGCTACTCGAGTAGCCAGAATTGAAGCCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016689.1-455s1c1
Sequence:CCGGCCTTTGCCAACAATGAGCTTTCTCGAGAAAGCTCATTGTTGGCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000439981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016689.2-603s21c1
Sequence:CCGGGCCATCGTTGACCCTTATAACCTCGAGGTTATAAGGGTCAACGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415505    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016689.2-1037s21c1
Sequence:CCGGTGATGCCTCTCTCGGGCTAAACTCGAGTTTAGCCCGAGAGAGGCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426908    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016689.2-1150s21c1
Sequence:CCGGCAAGGTAGGATAGCAAATAAGCTCGAGCTTATTTGCTATCCTACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016689.2-836s21c1
Sequence:CCGGCATCGCTGGTGTCTTCGTGTACTCGAGTACACGAAGACACCAGCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016689
AQP3 MISSION shRNA Lentiviral Transduction Particles
aquaporin 3 (Gill blood group)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000102168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016689.1-498s1c1
Sequence:CCGGAGCTGGAATCTTTGCCACCTACTCGAGTAGGTGGCAAAGATTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102165    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016689.1-1494s1c1
Sequence:CCGGGCTGTGTAATATGTTTCTGTTCTCGAGAACAGAAACATATTACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016689.1-429s1c1
Sequence:CCGGTGGGCTGTACTACGATGCAATCTCGAGATTGCATCGTAGTACAGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016689.1-681s1c1
Sequence:CCGGCATGGGCTTCAATTCTGGCTACTCGAGTAGCCAGAATTGAAGCCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016689.1-455s1c1
Sequence:CCGGCCTTTGCCAACAATGAGCTTTCTCGAGAAAGCTCATTGTTGGCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000439981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016689.2-603s21c1
Sequence:CCGGGCCATCGTTGACCCTTATAACCTCGAGGTTATAAGGGTCAACGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415505    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016689.2-1037s21c1
Sequence:CCGGTGATGCCTCTCTCGGGCTAAACTCGAGTTTAGCCCGAGAGAGGCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426908    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016689.2-1150s21c1
Sequence:CCGGCAAGGTAGGATAGCAAATAAGCTCGAGCTTATTTGCTATCCTACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016689.2-836s21c1
Sequence:CCGGCATCGCTGGTGTCTTCGTGTACTCGAGTACACGAAGACACCAGCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004925
VALIDATED
AQP3 MISSION shRNA Bacterial Glycerol Stock
aquaporin 3 (Gill blood group)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000059588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_004925.3-536s1c1
Sequence:CCGGCAATGGCTTCTTTGACCAGTTCTCGAGAACTGGTCAAAGAAGCCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_004925.3-422s1c1
Sequence:CCGGTGGGCTGTATTATGATGCAATCTCGAGATTGCATCATAATACAGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_004925.3-221s1c1
Sequence:CCGGCGGTGGTTTCCTCACCATCAACTCGAGTTGATGGTGAGGAAACCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_004925.3-886s1c1
Sequence:CCGGCCAACGAGGAAGAGAATGTGACTCGAGTCACATTCTCTTCCTCGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004925.3-397s21c1
Sequence:CCGGCCTTCTTGGGTGCTGGAATAGCTCGAGCTATTCCAGCACCCAAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004925.3-354s21c1
Sequence:CCGGTGGATCAAGCTGCCCATCTACCTCGAGGTAGATGGGCAGCTTGATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004925.3-678s21c1
Sequence:CCGGATGGGCTTCAACTCCGGCTATCTCGAGATAGCCGGAGTTGAAGCCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434871    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004925.3-1044s21c1
Sequence:CCGGGGCTAAGGAGCTCCCTATCTACTCGAGTAGATAGGGAGCTCCTTAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004925.3-825s21c1
Sequence:CCGGATTGCGGGTGTCTTCGTGTACCTCGAGGTACACGAAGACACCCGCAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435072    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004925.3-1151s21c1
Sequence:CCGGGAACCGGAATTTGGGTCAATACTCGAGTATTGACCCAAATTCCGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004925
VALIDATED
AQP3 MISSION shRNA shRNA Plasmid DNA
aquaporin 3 (Gill blood group)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000059588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_004925.3-536s1c1
Sequence:CCGGCAATGGCTTCTTTGACCAGTTCTCGAGAACTGGTCAAAGAAGCCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_004925.3-422s1c1
Sequence:CCGGTGGGCTGTATTATGATGCAATCTCGAGATTGCATCATAATACAGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_004925.3-221s1c1
Sequence:CCGGCGGTGGTTTCCTCACCATCAACTCGAGTTGATGGTGAGGAAACCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_004925.3-886s1c1
Sequence:CCGGCCAACGAGGAAGAGAATGTGACTCGAGTCACATTCTCTTCCTCGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004925.3-397s21c1
Sequence:CCGGCCTTCTTGGGTGCTGGAATAGCTCGAGCTATTCCAGCACCCAAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004925.3-354s21c1
Sequence:CCGGTGGATCAAGCTGCCCATCTACCTCGAGGTAGATGGGCAGCTTGATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004925.3-678s21c1
Sequence:CCGGATGGGCTTCAACTCCGGCTATCTCGAGATAGCCGGAGTTGAAGCCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434871    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004925.3-1044s21c1
Sequence:CCGGGGCTAAGGAGCTCCCTATCTACTCGAGTAGATAGGGAGCTCCTTAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004925.3-825s21c1
Sequence:CCGGATTGCGGGTGTCTTCGTGTACCTCGAGGTACACGAAGACACCCGCAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435072    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004925.3-1151s21c1
Sequence:CCGGGAACCGGAATTTGGGTCAATACTCGAGTATTGACCCAAATTCCGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004925
VALIDATED
AQP3 MISSION shRNA Lentiviral Transduction Particles
aquaporin 3 (Gill blood group)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000059588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_004925.3-536s1c1
Sequence:CCGGCAATGGCTTCTTTGACCAGTTCTCGAGAACTGGTCAAAGAAGCCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_004925.3-422s1c1
Sequence:CCGGTGGGCTGTATTATGATGCAATCTCGAGATTGCATCATAATACAGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_004925.3-221s1c1
Sequence:CCGGCGGTGGTTTCCTCACCATCAACTCGAGTTGATGGTGAGGAAACCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_004925.3-886s1c1
Sequence:CCGGCCAACGAGGAAGAGAATGTGACTCGAGTCACATTCTCTTCCTCGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004925.3-397s21c1
Sequence:CCGGCCTTCTTGGGTGCTGGAATAGCTCGAGCTATTCCAGCACCCAAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004925.3-354s21c1
Sequence:CCGGTGGATCAAGCTGCCCATCTACCTCGAGGTAGATGGGCAGCTTGATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004925.3-678s21c1
Sequence:CCGGATGGGCTTCAACTCCGGCTATCTCGAGATAGCCGGAGTTGAAGCCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434871    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004925.3-1044s21c1
Sequence:CCGGGGCTAAGGAGCTCCCTATCTACTCGAGTAGATAGGGAGCTCCTTAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004925.3-825s21c1
Sequence:CCGGATTGCGGGTGTCTTCGTGTACCTCGAGGTACACGAAGACACCCGCAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435072    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004925.3-1151s21c1
Sequence:CCGGGAACCGGAATTTGGGTCAATACTCGAGTATTGACCCAAATTCCGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks