EMAIL THIS PAGE TO A FRIEND

AQP4-AS1

AQP4 antisense RNA 1

152 Gene Product Result for
Synonyms: C18orf16 CHST9-AS1
Species: Human AQP4-AS1(147429)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153010 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153010 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153010 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153010 Rosetta Predictions human pricing
XR_040524 Rosetta Predictions human pricing
XR_040525 Rosetta Predictions human pricing
XR_040526 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153010 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00013574 predicted 1213
2 SASI_Hs01_00013575 predicted 1211
3 SASI_Hs01_00013576 predicted 579
4 SASI_Hs01_00013577 predicted 1301
5 SASI_Hs01_00013578 predicted 1007
6 SASI_Hs01_00013579 predicted 579
7 SASI_Hs01_00013580 predicted 1073
8 SASI_Hs01_00013581 predicted 1199
9 SASI_Hs01_00013582 predicted 537
10 SASI_Hs01_00013583 predicted 1303
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040524 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00519663 predicted 57
2 SASI_Hs02_00519664 predicted 161
3 SASI_Hs02_00519665 predicted 156
4 SASI_Hs02_00519666 predicted 28
5 SASI_Hs02_00519667 predicted 121
6 SASI_Hs02_00519668 predicted 61
7 SASI_Hs02_00519669 predicted 74
8 SASI_Hs02_00519670 predicted 128
9 SASI_Hs02_00519671 predicted 168
10 SASI_Hs02_00519672 predicted 51
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040525 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00519673 predicted 136
2 SASI_Hs02_00519674 predicted 241
3 SASI_Hs02_00519675 predicted 49
4 SASI_Hs02_00519676 predicted 238
5 SASI_Hs02_00519677 predicted 202
6 SASI_Hs02_00519678 predicted 141
7 SASI_Hs02_00519679 predicted 157
8 SASI_Hs02_00519680 predicted 204
9 SASI_Hs02_00519681 predicted 252
10 SASI_Hs02_00519682 predicted 46
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040526 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00519683 predicted 52
2 SASI_Hs02_00519684 predicted 158
3 SASI_Hs02_00519685 predicted 157
4 SASI_Hs02_00519686 predicted 24
5 SASI_Hs02_00519687 predicted 122
6 SASI_Hs02_00519688 predicted 60
7 SASI_Hs02_00519689 predicted 78
8 SASI_Hs02_00519690 predicted 124
9 SASI_Hs02_00519691 predicted 160
10 SASI_Hs02_00519692 predicted 51
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153010
AQP4-AS1 MISSION shRNA Bacterial Glycerol Stock
AQP4 antisense RNA 1
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000162545    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153010.3-475s1c1
Sequence:CCGGCAGCGTCTTCTTCAAGGTATTCTCGAGAATACCTTGAAGAAGACGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161251    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153010.3-586s1c1
Sequence:CCGGGCCAACATTATTACCTCAGCTCTCGAGAGCTGAGGTAATAATGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159437    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153010.3-652s1c1
Sequence:CCGGGCACCTACTATGTGCATTATTCTCGAGAATAATGCACATAGTAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160032    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153010.3-1730s1c1
Sequence:CCGGCCATCTGTTGATGAACATATTCTCGAGAATATGTTCATCAACAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162499    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153010.3-548s1c1
Sequence:CCGGCTACACGTGCATAGACCAATTCTCGAGAATTGGTCTATGCACGTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162434    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153010.3-553s1c1
Sequence:CCGGCGTGCATAGACCAATTTGCAACTCGAGTTGCAAATTGGTCTATGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153010
AQP4-AS1 MISSION shRNA shRNA Plasmid DNA
AQP4 antisense RNA 1
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000162545    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153010.3-475s1c1
Sequence:CCGGCAGCGTCTTCTTCAAGGTATTCTCGAGAATACCTTGAAGAAGACGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161251    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153010.3-586s1c1
Sequence:CCGGGCCAACATTATTACCTCAGCTCTCGAGAGCTGAGGTAATAATGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159437    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153010.3-652s1c1
Sequence:CCGGGCACCTACTATGTGCATTATTCTCGAGAATAATGCACATAGTAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160032    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153010.3-1730s1c1
Sequence:CCGGCCATCTGTTGATGAACATATTCTCGAGAATATGTTCATCAACAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162499    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153010.3-548s1c1
Sequence:CCGGCTACACGTGCATAGACCAATTCTCGAGAATTGGTCTATGCACGTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162434    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153010.3-553s1c1
Sequence:CCGGCGTGCATAGACCAATTTGCAACTCGAGTTGCAAATTGGTCTATGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153010
AQP4-AS1 MISSION shRNA Lentiviral Transduction Particles
AQP4 antisense RNA 1
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000162545    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153010.3-475s1c1
Sequence:CCGGCAGCGTCTTCTTCAAGGTATTCTCGAGAATACCTTGAAGAAGACGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161251    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153010.3-586s1c1
Sequence:CCGGGCCAACATTATTACCTCAGCTCTCGAGAGCTGAGGTAATAATGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159437    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153010.3-652s1c1
Sequence:CCGGGCACCTACTATGTGCATTATTCTCGAGAATAATGCACATAGTAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160032    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153010.3-1730s1c1
Sequence:CCGGCCATCTGTTGATGAACATATTCTCGAGAATATGTTCATCAACAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162499    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153010.3-548s1c1
Sequence:CCGGCTACACGTGCATAGACCAATTCTCGAGAATTGGTCTATGCACGTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162434    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153010.3-553s1c1
Sequence:CCGGCGTGCATAGACCAATTTGCAACTCGAGTTGCAAATTGGTCTATGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks