EMAIL THIS PAGE TO A FRIEND

AQP4

aquaporin 4

225 Gene Product Result for
Synonyms: HMIWC2 MIWC
UniProtKB ID: P55087, P78564
Gene ID:
Human(361) Summary: This gene encodes a member of the aquaporin family of intrinsic membrane proteins that function as water-selective channels in the plasma membranes of many cells. The encoded protein is the predominant aquaporin found in brain. Two alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(11829) aquaporin 4
Rat(25293) aquaporin 4
Zebrafish(445293) aquaporin 4
dog(612628) aquaporin 4
cow(281008) aquaporin 4
chicken(421088) aquaporin 4
sheep(443268) aquaporin 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004028 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004028 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004028 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009700 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009700 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009700 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU041431 MISSION® esiRNA esiRNA human AQP4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001650 Rosetta Predictions human pricing
NM_004028 Rosetta Predictions human pricing
NM_012825 Rosetta Predictions rat pricing
NM_009700 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001650 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00213738 predicted 857
2 SASI_Hs01_00213739 predicted 1062
3 SASI_Hs01_00213741 predicted 1011
4 SASI_Hs01_00213742 predicted 993
5 SASI_Hs01_00213743 predicted 621
6 SASI_Hs02_00332242 predicted 1099
7 SASI_Hs01_00213744 predicted 1089
8 SASI_Hs02_00332243 predicted 580
9 SASI_Hs01_00213745 predicted 1059
10 SASI_Hs01_00213747 predicted 798
11 SASI_Hs01_00213740 predicted 1055
12 SASI_Hs01_00213746 predicted 660
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004028 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00245322 predicted 778
2 SASI_Hs01_00245323 predicted 983
3 SASI_Hs01_00245325 predicted 936
4 SASI_Hs01_00245326 predicted 916
5 SASI_Hs01_00245327 predicted 543
6 SASI_Hs02_00336775 predicted 1015
7 SASI_Hs01_00245328 predicted 1007
8 SASI_Hs02_00336776 predicted 493
9 SASI_Hs01_00245329 predicted 983
10 SASI_Hs01_00245331 predicted 717
11 SASI_Hs01_00245324 predicted 977
12 SASI_Hs01_00245330 predicted 587
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012825 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00105009 predicted 595
2 SASI_Rn01_00105010 predicted 731
3 SASI_Rn01_00105011 predicted 688
4 SASI_Rn02_00260276 predicted 1031
5 SASI_Rn01_00105012 predicted 1032
6 SASI_Rn01_00105013 predicted 279
7 SASI_Rn01_00105014 predicted 1002
8 SASI_Rn01_00105015 predicted 1061
9 SASI_Rn01_00105016 predicted 944
10 SASI_Rn01_00105017 predicted 544
11 SASI_Rn01_00105008 predicted 1029
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009700 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00141829 predicted 646
2 SASI_Mm01_00141831 predicted 596
3 SASI_Mm01_00141832 predicted 291
4 SASI_Mm01_00141833 predicted 938
5 SASI_Mm01_00141834 predicted 733
6 SASI_Mm01_00141835 predicted 428
7 SASI_Mm02_00316828 predicted 727
8 SASI_Mm01_00141836 predicted 353
9 SASI_Mm02_00316829 predicted 1391
10 SASI_Mm01_00141837 predicted 595
11 SASI_Mm01_00141830 predicted 813
12 SASI_Mm01_00141838 predicted 600
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004028
AQP4 MISSION shRNA Bacterial Glycerol Stock
aquaporin 4
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000059608    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004028.2-3267s1c1
Sequence:CCGGGCATTCAATAAGTTACGGTTACTCGAGTAACCGTAACTTATTGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004028.2-339s1c1
Sequence:CCGGCGGAATTTCTGGCCATGCTTACTCGAGTAAGCATGGCCAGAAATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004028.2-553s1c1
Sequence:CCGGCATCGCCAAGTCTGTCTTCTACTCGAGTAGAAGACAGACTTGGCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004028.2-1082s1c1
Sequence:CCGGGAGACGGATGACCTGATTCTACTCGAGTAGAATCAGGTCATCCGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004028.2-878s1c1
Sequence:CCGGCCTGCAGTTATCATGGGAAATCTCGAGATTTCCCATGATAACTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004028
AQP4 MISSION shRNA shRNA Plasmid DNA
aquaporin 4
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000059608    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004028.2-3267s1c1
Sequence:CCGGGCATTCAATAAGTTACGGTTACTCGAGTAACCGTAACTTATTGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004028.2-339s1c1
Sequence:CCGGCGGAATTTCTGGCCATGCTTACTCGAGTAAGCATGGCCAGAAATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004028.2-553s1c1
Sequence:CCGGCATCGCCAAGTCTGTCTTCTACTCGAGTAGAAGACAGACTTGGCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004028.2-1082s1c1
Sequence:CCGGGAGACGGATGACCTGATTCTACTCGAGTAGAATCAGGTCATCCGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004028.2-878s1c1
Sequence:CCGGCCTGCAGTTATCATGGGAAATCTCGAGATTTCCCATGATAACTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004028
AQP4 MISSION shRNA Lentiviral Transduction Particles
aquaporin 4
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000059608    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004028.2-3267s1c1
Sequence:CCGGGCATTCAATAAGTTACGGTTACTCGAGTAACCGTAACTTATTGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004028.2-339s1c1
Sequence:CCGGCGGAATTTCTGGCCATGCTTACTCGAGTAAGCATGGCCAGAAATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004028.2-553s1c1
Sequence:CCGGCATCGCCAAGTCTGTCTTCTACTCGAGTAGAAGACAGACTTGGCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004028.2-1082s1c1
Sequence:CCGGGAGACGGATGACCTGATTCTACTCGAGTAGAATCAGGTCATCCGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004028.2-878s1c1
Sequence:CCGGCCTGCAGTTATCATGGGAAATCTCGAGATTTCCCATGATAACTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009700
AQP4 MISSION shRNA Bacterial Glycerol Stock
aquaporin 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000119597    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009700.1-1084s1c1
Sequence:CCGGCCACCCATTAAGGAAACACATCTCGAGATGTGTTTCCTTAATGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009700.1-1004s1c1
Sequence:CCGGGAGAGGTATTGTCTTCCGTATCTCGAGATACGGAAGACAATACCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009700.1-647s1c1
Sequence:CCGGCAATTGGACATTTGTTTGCAACTCGAGTTGCAAACAAATGTCCAATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009700.1-711s1c1
Sequence:CCGGACCCGCAGTTATCATGGGAAACTCGAGTTTCCCATGATAACTGCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009700.1-599s1c1
Sequence:CCGGGAACTGATGTTACTGGTTCAACTCGAGTTGAACCAGTAACATCAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009700
AQP4 MISSION shRNA shRNA Plasmid DNA
aquaporin 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000119597    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009700.1-1084s1c1
Sequence:CCGGCCACCCATTAAGGAAACACATCTCGAGATGTGTTTCCTTAATGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009700.1-1004s1c1
Sequence:CCGGGAGAGGTATTGTCTTCCGTATCTCGAGATACGGAAGACAATACCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009700.1-647s1c1
Sequence:CCGGCAATTGGACATTTGTTTGCAACTCGAGTTGCAAACAAATGTCCAATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009700.1-711s1c1
Sequence:CCGGACCCGCAGTTATCATGGGAAACTCGAGTTTCCCATGATAACTGCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009700.1-599s1c1
Sequence:CCGGGAACTGATGTTACTGGTTCAACTCGAGTTGAACCAGTAACATCAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009700
AQP4 MISSION shRNA Lentiviral Transduction Particles
aquaporin 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000119597    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009700.1-1084s1c1
Sequence:CCGGCCACCCATTAAGGAAACACATCTCGAGATGTGTTTCCTTAATGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009700.1-1004s1c1
Sequence:CCGGGAGAGGTATTGTCTTCCGTATCTCGAGATACGGAAGACAATACCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009700.1-647s1c1
Sequence:CCGGCAATTGGACATTTGTTTGCAACTCGAGTTGCAAACAAATGTCCAATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009700.1-711s1c1
Sequence:CCGGACCCGCAGTTATCATGGGAAACTCGAGTTTCCCATGATAACTGCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009700.1-599s1c1
Sequence:CCGGGAACTGATGTTACTGGTTCAACTCGAGTTGAACCAGTAACATCAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks