EMAIL THIS PAGE TO A FRIEND

AQP5

aquaporin 5

59 Gene Product Result for
Synonyms: AQP-5
UniProtKB ID: P55064, Q6FGW8
Gene ID:
Human(362) Summary: Aquaporin 5 (AQP5) is a water channel protein. Aquaporins are a family of small integral membrane proteins related to the major intrinsic protein (MIP or AQP0). Aquaporin 5 plays a role in the generation of saliva, tears and pulmonary secretions. AQP0, AQP2, AQP5, and AQP6 are closely related and all map to 12q13. [provided by RefSeq, Jul 2008]
Mouse(11830) aquaporin 5
Rat(25241) aquaporin 5
chicken(431305) aquaporin 5
Horse(100136906) aquaporin 5
cow(782368) aquaporin 5
dog(486551) aquaporin 5
sheep(443251) aquaporin 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009701 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009701 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009701 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001651 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001651 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001651 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU046331 MISSION® esiRNA esiRNA human AQP5 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001651 Rosetta Predictions human pricing
NM_012779 Rosetta Predictions rat pricing
NM_009701 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001651 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00332244 predicted 1377
2 SASI_Hs01_00106043 predicted 742
3 SASI_Hs02_00332245 predicted 1538
4 SASI_Hs01_00106044 predicted 1033
5 SASI_Hs02_00332246 predicted 1544
6 SASI_Hs02_00332247 predicted 1573
7 SASI_Hs01_00106049 predicted 1215
8 SASI_Hs02_00332248 predicted 1529
9 SASI_Hs01_00106051 predicted 1164
10 SASI_Hs02_00332249 predicted 1463
11 SASI_Hs01_00106042 predicted 1033
12 SASI_Hs01_00106045 predicted 935
13 SASI_Hs01_00106046 predicted 910
14 SASI_Hs01_00106047 predicted 1046
15 SASI_Hs01_00106048 predicted 884
16 SASI_Hs01_00106050 predicted 664
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012779 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00260182 predicted 1109
2 SASI_Rn01_00082958 predicted 1111
3 SASI_Rn01_00082959 predicted 871
4 SASI_Rn01_00082960 predicted 587
5 SASI_Rn01_00082961 predicted 290
6 SASI_Rn01_00082962 predicted 491
7 SASI_Rn01_00082963 predicted 230
8 SASI_Rn01_00082964 predicted 224
9 SASI_Rn01_00082965 predicted 1105
10 SASI_Rn02_00260183 predicted 709
11 SASI_Rn01_00082956 predicted 311
12 SASI_Rn01_00082957 predicted 460
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009701 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00316830 predicted 1324
2 SASI_Mm01_00117844 predicted 1246
3 SASI_Mm01_00117845 predicted 1008
4 SASI_Mm02_00316831 predicted 1221
5 SASI_Mm02_00316832 predicted 1284
6 SASI_Mm02_00316833 predicted 438
7 SASI_Mm01_00117846 predicted 718
8 SASI_Mm01_00117847 predicted 887
9 SASI_Mm01_00117849 predicted 892
10 SASI_Mm01_00117851 predicted 424
11 SASI_Mm01_00117848 predicted 1353
12 SASI_Mm01_00117850 predicted 852
13 SASI_Mm01_00117852 predicted 1231
14 SASI_Mm01_00117853 predicted 799
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009701
AQP5 MISSION shRNA Bacterial Glycerol Stock
aquaporin 5
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000105620    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009701.3-1603s1c1
Sequence:CCGGCCCAGTATCTCATGTGCCAAACTCGAGTTTGGCACATGAGATACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009701.3-705s1c1
Sequence:CCGGCCATTACTCTGGCCCTCTTAACTCGAGTTAAGAGGGCCAGAGTAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009701.3-973s1c1
Sequence:CCGGCCCAGCCTTATCCATTGGCTTCTCGAGAAGCCAATGGATAAGGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009701.3-1202s1c1
Sequence:CCGGGCTGTGGTCAAAGGCACATATCTCGAGATATGTGCCTTTGACCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009701.3-718s1c1
Sequence:CCGGCCTCTTAATAGGCAACCAGATCTCGAGATCTGGTTGCCTATTAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009701
AQP5 MISSION shRNA shRNA Plasmid DNA
aquaporin 5
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000105620    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009701.3-1603s1c1
Sequence:CCGGCCCAGTATCTCATGTGCCAAACTCGAGTTTGGCACATGAGATACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009701.3-705s1c1
Sequence:CCGGCCATTACTCTGGCCCTCTTAACTCGAGTTAAGAGGGCCAGAGTAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009701.3-973s1c1
Sequence:CCGGCCCAGCCTTATCCATTGGCTTCTCGAGAAGCCAATGGATAAGGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009701.3-1202s1c1
Sequence:CCGGGCTGTGGTCAAAGGCACATATCTCGAGATATGTGCCTTTGACCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009701.3-718s1c1
Sequence:CCGGCCTCTTAATAGGCAACCAGATCTCGAGATCTGGTTGCCTATTAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009701
AQP5 MISSION shRNA Lentiviral Transduction Particles
aquaporin 5
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000105620    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009701.3-1603s1c1
Sequence:CCGGCCCAGTATCTCATGTGCCAAACTCGAGTTTGGCACATGAGATACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009701.3-705s1c1
Sequence:CCGGCCATTACTCTGGCCCTCTTAACTCGAGTTAAGAGGGCCAGAGTAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009701.3-973s1c1
Sequence:CCGGCCCAGCCTTATCCATTGGCTTCTCGAGAAGCCAATGGATAAGGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009701.3-1202s1c1
Sequence:CCGGGCTGTGGTCAAAGGCACATATCTCGAGATATGTGCCTTTGACCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009701.3-718s1c1
Sequence:CCGGCCTCTTAATAGGCAACCAGATCTCGAGATCTGGTTGCCTATTAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001651
AQP5 MISSION shRNA Bacterial Glycerol Stock
aquaporin 5
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000059633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001651.1-1034s1c1
Sequence:CCGGCCACCTTGTCGGAATCTACTTCTCGAGAAGTAGATTCCGACAAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001651.1-877s1c1
Sequence:CCGGACGCGCTCAACAACAACACAACTCGAGTTGTGTTGTTGTTGAGCGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001651.1-770s1c1
Sequence:CCGGGCTCCGGGCTTTCTTCTACGTCTCGAGACGTAGAAGAAAGCCCGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001651.2-838s21c1
Sequence:CCGGTACGGTGTGGCACCGCTCAATCTCGAGATTGAGCGGTGCCACACCGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001651.2-555s21c1
Sequence:CCGGCAAGGCCGTGTTCGCAGAGTTCTCGAGAACTCTGCGAACACGGCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001651.2-1232s21c1
Sequence:CCGGCCATCATCAAAGGCACGTATGCTCGAGCATACGTGCCTTTGATGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001651
AQP5 MISSION shRNA shRNA Plasmid DNA
aquaporin 5
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000059633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001651.1-1034s1c1
Sequence:CCGGCCACCTTGTCGGAATCTACTTCTCGAGAAGTAGATTCCGACAAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001651.1-877s1c1
Sequence:CCGGACGCGCTCAACAACAACACAACTCGAGTTGTGTTGTTGTTGAGCGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001651.1-770s1c1
Sequence:CCGGGCTCCGGGCTTTCTTCTACGTCTCGAGACGTAGAAGAAAGCCCGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001651.2-838s21c1
Sequence:CCGGTACGGTGTGGCACCGCTCAATCTCGAGATTGAGCGGTGCCACACCGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001651.2-555s21c1
Sequence:CCGGCAAGGCCGTGTTCGCAGAGTTCTCGAGAACTCTGCGAACACGGCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001651.2-1232s21c1
Sequence:CCGGCCATCATCAAAGGCACGTATGCTCGAGCATACGTGCCTTTGATGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001651
AQP5 MISSION shRNA Lentiviral Transduction Particles
aquaporin 5
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000059633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001651.1-1034s1c1
Sequence:CCGGCCACCTTGTCGGAATCTACTTCTCGAGAAGTAGATTCCGACAAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001651.1-877s1c1
Sequence:CCGGACGCGCTCAACAACAACACAACTCGAGTTGTGTTGTTGTTGAGCGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001651.1-770s1c1
Sequence:CCGGGCTCCGGGCTTTCTTCTACGTCTCGAGACGTAGAAGAAAGCCCGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001651.2-838s21c1
Sequence:CCGGTACGGTGTGGCACCGCTCAATCTCGAGATTGAGCGGTGCCACACCGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001651.2-555s21c1
Sequence:CCGGCAAGGCCGTGTTCGCAGAGTTCTCGAGAACTCTGCGAACACGGCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001651.2-1232s21c1
Sequence:CCGGCCATCATCAAAGGCACGTATGCTCGAGCATACGTGCCTTTGATGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks