EMAIL THIS PAGE TO A FRIEND

AQP6

aquaporin 6, kidney specific

60 Gene Product Result for
Synonyms: AQP2L KID
UniProtKB ID: Q13520
Gene ID:
Human(363) Summary: The protein encoded by this gene is an aquaporin protein, which functions as a water channel in cells. Aquaporins are a family of small integral membrane proteins related to the major intrinsic protein (MIP or AQP0). This protein is specific for the kidney. This gene and related family members AQP0, AQP2, and AQP5 reside in a cluster on chromosome 12q13. [provided by RefSeq, Jul 2008]
Mouse(11831) aquaporin 6
Rat(29170) aquaporin 6, kidney specific
domestic guinea pig(100721452) aquaporin 6, kidney specific
naked mole-rat(101705612) aquaporin 6, kidney specific
sheep(101121248) aquaporin 6, kidney specific
domestic cat(101093446) aquaporin 6, kidney specific
dog(607978) aquaporin 6, kidney specific
cow(527759) aquaporin 6, kidney specific
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001652 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001652 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001652 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175087 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175087 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175087 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001652 Rosetta Predictions human pricing
NM_022181 Rosetta Predictions rat pricing
NM_175087 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001652 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00023300 predicted 707
2 SASI_Hs01_00023302 predicted 719
3 SASI_Hs01_00023303 predicted 1323
4 SASI_Hs01_00023305 predicted 1070
5 SASI_Hs01_00023307 predicted 1315
6 SASI_Hs01_00023308 predicted 935
7 SASI_Hs01_00023309 predicted 595
8 SASI_Hs02_00332250 predicted 1517
9 SASI_Hs02_00332251 predicted 856
10 SASI_Hs02_00332252 predicted 877
11 SASI_Hs01_00023301 predicted 1347
12 SASI_Hs01_00023304 predicted 1326
13 SASI_Hs01_00023306 predicted 492
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022181 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00035018 predicted 805
2 SASI_Rn01_00035019 predicted 938
3 SASI_Rn01_00035020 predicted 870
4 SASI_Rn01_00035021 predicted 934
5 SASI_Rn01_00035022 predicted 735
6 SASI_Rn01_00035023 predicted 388
7 SASI_Rn01_00035024 predicted 743
8 SASI_Rn01_00035025 predicted 951
9 SASI_Rn01_00035027 predicted 1041
10 SASI_Rn02_00262926 predicted 585
11 SASI_Rn01_00035026 predicted 335
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175087 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00165408 predicted 261
2 SASI_Mm01_00165409 predicted 677
3 SASI_Mm02_00345659 predicted 799
4 SASI_Mm02_00345660 predicted 815
5 SASI_Mm01_00165410 predicted 260
6 SASI_Mm01_00165411 predicted 608
7 SASI_Mm01_00165415 predicted 818
8 SASI_Mm01_00165412 predicted 545
9 SASI_Mm01_00165417 predicted 394
10 SASI_Mm02_00345661 predicted 736
11 SASI_Mm01_00165413 predicted 28
12 SASI_Mm01_00165414 predicted 65
13 SASI_Mm01_00165416 predicted 681
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001652
AQP6 MISSION shRNA Bacterial Glycerol Stock
aquaporin 6, kidney specific
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000447491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001652.3-740s21c1
Sequence:CCGGGTCCGGAACAGTGTCTCAACTCTCGAGAGTTGAGACACTGTTCCGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427689    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001652.3-1341s21c1
Sequence:CCGGGTAGAATCTGGGAGTGAATTTCTCGAGAAATTCACTCCCAGATTCTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432804    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001652.3-1534s21c1
Sequence:CCGGGCTTAGACATGGGAGCTATAGCTCGAGCTATAGCTCCCATGTCTAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000439056    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001652.3-1311s21c1
Sequence:CCGCCAAGCCCTATCCCTGGCATTACTCGAGTAATGCCAGGGATAGGGCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001652.2-856s1c1
Sequence:CCGGCCACCATGATTGGGATCTCTTCTCGAGAAGAGATCCCAATCATGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001652.2-503s1c1
Sequence:CCGGGCTACAGATTGCCATCACCTTCTCGAGAAGGTGATGGCAATCTGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001652.2-1025s1c1
Sequence:CCGGGATCTACAACTTCGTCCTGTTCTCGAGAACAGGACGAAGTTGTAGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001652.2-713s1c1
Sequence:CCGGCATCCGAGAGACCCTTGGGATCTCGAGATCCCAAGGGTCTCTCGGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001652.2-944s1c1
Sequence:CCGGCCCTGCCATCATCATTGGGAACTCGAGTTCCCAATGATGATGGCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001652
AQP6 MISSION shRNA shRNA Plasmid DNA
aquaporin 6, kidney specific
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000447491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001652.3-740s21c1
Sequence:CCGGGTCCGGAACAGTGTCTCAACTCTCGAGAGTTGAGACACTGTTCCGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427689    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001652.3-1341s21c1
Sequence:CCGGGTAGAATCTGGGAGTGAATTTCTCGAGAAATTCACTCCCAGATTCTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432804    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001652.3-1534s21c1
Sequence:CCGGGCTTAGACATGGGAGCTATAGCTCGAGCTATAGCTCCCATGTCTAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000439056    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001652.3-1311s21c1
Sequence:CCGCCAAGCCCTATCCCTGGCATTACTCGAGTAATGCCAGGGATAGGGCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001652.2-856s1c1
Sequence:CCGGCCACCATGATTGGGATCTCTTCTCGAGAAGAGATCCCAATCATGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001652.2-503s1c1
Sequence:CCGGGCTACAGATTGCCATCACCTTCTCGAGAAGGTGATGGCAATCTGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001652.2-1025s1c1
Sequence:CCGGGATCTACAACTTCGTCCTGTTCTCGAGAACAGGACGAAGTTGTAGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001652.2-713s1c1
Sequence:CCGGCATCCGAGAGACCCTTGGGATCTCGAGATCCCAAGGGTCTCTCGGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001652.2-944s1c1
Sequence:CCGGCCCTGCCATCATCATTGGGAACTCGAGTTCCCAATGATGATGGCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001652
AQP6 MISSION shRNA Lentiviral Transduction Particles
aquaporin 6, kidney specific
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000447491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001652.3-740s21c1
Sequence:CCGGGTCCGGAACAGTGTCTCAACTCTCGAGAGTTGAGACACTGTTCCGGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427689    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001652.3-1341s21c1
Sequence:CCGGGTAGAATCTGGGAGTGAATTTCTCGAGAAATTCACTCCCAGATTCTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432804    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001652.3-1534s21c1
Sequence:CCGGGCTTAGACATGGGAGCTATAGCTCGAGCTATAGCTCCCATGTCTAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000439056    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001652.3-1311s21c1
Sequence:CCGCCAAGCCCTATCCCTGGCATTACTCGAGTAATGCCAGGGATAGGGCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001652.2-856s1c1
Sequence:CCGGCCACCATGATTGGGATCTCTTCTCGAGAAGAGATCCCAATCATGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001652.2-503s1c1
Sequence:CCGGGCTACAGATTGCCATCACCTTCTCGAGAAGGTGATGGCAATCTGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001652.2-1025s1c1
Sequence:CCGGGATCTACAACTTCGTCCTGTTCTCGAGAACAGGACGAAGTTGTAGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001652.2-713s1c1
Sequence:CCGGCATCCGAGAGACCCTTGGGATCTCGAGATCCCAAGGGTCTCTCGGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001652.2-944s1c1
Sequence:CCGGCCCTGCCATCATCATTGGGAACTCGAGTTCCCAATGATGATGGCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175087
AQP6 MISSION shRNA Bacterial Glycerol Stock
aquaporin 6, kidney specific
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000412987    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175087.4-976s21c1
Sequence:CCGGGTAATGTTGCTTTCATGTTTCCTCGAGGAAACATGAAAGCAACATTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175087.4-263s21c1
Sequence:CCGGCTACCTCGTGGGATCCCATATCTCGAGATATGGGATCCCACGAGGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428874    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175087.4-1085s21c1
Sequence:CCGGCCTTAGTTCCCTCAATCTACTCTCGAGAGTAGATTGAGGGAACTAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175087.4-627s21c1
Sequence:CCGGTTCGCAGTCCATTGGATCTTCCTCGAGGAAGATCCAATGGACTGCGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105610    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175087.2-1774s1c1
Sequence:CCGGCCTGTTAAATAGTGAGGCTATCTCGAGATAGCCTCACTATTTAACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175087.2-679s1c1
Sequence:CCGGGCTTCGCTGATCTACAACTTTCTCGAGAAAGTTGTAGATCAGCGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175087.2-169s1c1
Sequence:CCGGCAGATCGCCATCACCTTCAATCTCGAGATTGAAGGTGATGGCGATCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175087.2-291s1c1
Sequence:CCGGGCCTCGGGCTATGGCCTATATCTCGAGATATAGGCCATAGCCCGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175087.2-788s1c1
Sequence:CCGGCCCAGAAGAAAGAATCACAGACTCGAGTCTGTGATTCTTTCTTCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175087
AQP6 MISSION shRNA shRNA Plasmid DNA
aquaporin 6, kidney specific
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000412987    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175087.4-976s21c1
Sequence:CCGGGTAATGTTGCTTTCATGTTTCCTCGAGGAAACATGAAAGCAACATTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175087.4-263s21c1
Sequence:CCGGCTACCTCGTGGGATCCCATATCTCGAGATATGGGATCCCACGAGGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428874    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175087.4-1085s21c1
Sequence:CCGGCCTTAGTTCCCTCAATCTACTCTCGAGAGTAGATTGAGGGAACTAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175087.4-627s21c1
Sequence:CCGGTTCGCAGTCCATTGGATCTTCCTCGAGGAAGATCCAATGGACTGCGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105610    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175087.2-1774s1c1
Sequence:CCGGCCTGTTAAATAGTGAGGCTATCTCGAGATAGCCTCACTATTTAACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175087.2-679s1c1
Sequence:CCGGGCTTCGCTGATCTACAACTTTCTCGAGAAAGTTGTAGATCAGCGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175087.2-169s1c1
Sequence:CCGGCAGATCGCCATCACCTTCAATCTCGAGATTGAAGGTGATGGCGATCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175087.2-291s1c1
Sequence:CCGGGCCTCGGGCTATGGCCTATATCTCGAGATATAGGCCATAGCCCGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175087.2-788s1c1
Sequence:CCGGCCCAGAAGAAAGAATCACAGACTCGAGTCTGTGATTCTTTCTTCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175087
AQP6 MISSION shRNA Lentiviral Transduction Particles
aquaporin 6, kidney specific
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000412987    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175087.4-976s21c1
Sequence:CCGGGTAATGTTGCTTTCATGTTTCCTCGAGGAAACATGAAAGCAACATTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175087.4-263s21c1
Sequence:CCGGCTACCTCGTGGGATCCCATATCTCGAGATATGGGATCCCACGAGGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428874    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175087.4-1085s21c1
Sequence:CCGGCCTTAGTTCCCTCAATCTACTCTCGAGAGTAGATTGAGGGAACTAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175087.4-627s21c1
Sequence:CCGGTTCGCAGTCCATTGGATCTTCCTCGAGGAAGATCCAATGGACTGCGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105610    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175087.2-1774s1c1
Sequence:CCGGCCTGTTAAATAGTGAGGCTATCTCGAGATAGCCTCACTATTTAACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175087.2-679s1c1
Sequence:CCGGGCTTCGCTGATCTACAACTTTCTCGAGAAAGTTGTAGATCAGCGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175087.2-169s1c1
Sequence:CCGGCAGATCGCCATCACCTTCAATCTCGAGATTGAAGGTGATGGCGATCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175087.2-291s1c1
Sequence:CCGGGCCTCGGGCTATGGCCTATATCTCGAGATATAGGCCATAGCCCGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175087.2-788s1c1
Sequence:CCGGCCCAGAAGAAAGAATCACAGACTCGAGTCTGTGATTCTTTCTTCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)