EMAIL THIS PAGE TO A FRIEND

AQP7

aquaporin 7

62 Gene Product Result for
Synonyms: AQP7L AQP9 AQPap GLYCQTL
UniProtKB ID: O14520, Q5T5L9, Q8NHM3
Gene ID:
Human(364) Summary: Aquaporins/major intrinsic protein (MIP) are a family of water-selective membrane channels. Aquaporin 7 has greater sequence similarity with AQP3 and AQP9 and they may be a subfamily. Aquaporin 7 and AQP3 are at the same chromosomal location suggesting that 9p13 may be a site of an aquaporin cluster. Aquaporin 7 facilitates water, glycerol and urea transport. It may play an important role in sperm function. [provided by RefSeq, Jul 2008]
Mouse(11832) aquaporin 7
Rat(29171) aquaporin 7
Zebrafish(334529) aquaporin 7
chicken(426892) aquaporin 7
cow(615498) aquaporin 7
dog(474742) aquaporin 7
sheep(101103697) aquaporin 7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001170 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001170 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001170 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007473 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007473 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007473 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU111101 MISSION® esiRNA esiRNA human AQP7 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001170 Rosetta Predictions human pricing
NM_019157 Rosetta Predictions rat pricing
NM_007473 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001170 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00128271 predicted 961
2 SASI_Hs01_00128272 predicted 557
3 SASI_Hs01_00128273 predicted 448
4 SASI_Hs01_00128274 predicted 301
5 SASI_Hs02_00331293 predicted 255
6 SASI_Hs02_00331294 predicted 431
7 SASI_Hs01_00128275 predicted 761
8 SASI_Hs01_00128278 predicted 1026
9 SASI_Hs02_00331295 predicted 269
10 SASI_Hs01_00128280 predicted 448
11 SASI_Hs01_00128276 predicted 365
12 SASI_Hs01_00128277 predicted 904
13 SASI_Hs01_00128279 predicted 403
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019157 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00102025 predicted 333
2 SASI_Rn02_00261936 predicted 1012
3 SASI_Rn01_00102027 predicted 756
4 SASI_Rn01_00102028 predicted 405
5 SASI_Rn01_00102029 predicted 541
6 SASI_Rn01_00102030 predicted 379
7 SASI_Rn01_00102031 predicted 1006
8 SASI_Rn01_00102032 predicted 661
9 SASI_Rn01_00102033 predicted 307
10 SASI_Rn02_00261937 predicted 388
11 SASI_Rn01_00102026 predicted 563
12 SASI_Rn01_00102034 predicted 695
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007473 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00311708 predicted 514
2 SASI_Mm02_00311709 predicted 502
3 SASI_Mm02_00311710 predicted 967
4 SASI_Mm02_00311711 predicted 843
5 SASI_Mm02_00311712 predicted 524
6 SASI_Mm02_00311713 predicted 1346
7 SASI_Mm02_00311714 predicted 719
8 SASI_Mm02_00311715 predicted 1130
9 SASI_Mm02_00311716 predicted 731
10 SASI_Mm02_00311717 predicted 479
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001170
AQP7 MISSION shRNA Bacterial Glycerol Stock
aquaporin 7
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000059693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001170.1-458s1c1
Sequence:CCGGGCTGTGACCTTTGCTAACTGTCTCGAGACAGTTAGCAAAGGTCACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001170.1-1047s1c1
Sequence:CCGGCGTATGAAGACCACGGGATAACTCGAGTTATCCCGTGGTCTTCATACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001170.1-287s1c1
Sequence:CCGGGCCGAGTTCATGAGCACATATCTCGAGATATGTGCTCATGAACTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001170.1-820s1c1
Sequence:CCGGCCTTGGCATGAACACAGGATACTCGAGTATCCTGTGTTCATGCCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001170.1-373s1c1
Sequence:CCGGCCTTGGTGTCAACTTGGGTTTCTCGAGAAACCCAAGTTGACACCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001170.1-1032s21c1
Sequence:CCGGTGGAGGATTCTGTGGCGTATGCTCGAGCATACGCCACAGAATCCTCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001170.1-498s21c1
Sequence:CCGGGGAGGAAGTTTCCGGTCTATGCTCGAGCATAGACCGGAAACTTCCTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001170.1-770s21c1
Sequence:CCGGGGAACAGAGGCGCTGGTGATACTCGAGTATCACCAGCGCCTCTGTTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001170.1-966s21c1
Sequence:CCGGCCTATCTAGGTGGCATCATCTCTCGAGAGATGATGCCACCTAGATAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001170
AQP7 MISSION shRNA shRNA Plasmid DNA
aquaporin 7
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000059693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001170.1-458s1c1
Sequence:CCGGGCTGTGACCTTTGCTAACTGTCTCGAGACAGTTAGCAAAGGTCACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001170.1-1047s1c1
Sequence:CCGGCGTATGAAGACCACGGGATAACTCGAGTTATCCCGTGGTCTTCATACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001170.1-287s1c1
Sequence:CCGGGCCGAGTTCATGAGCACATATCTCGAGATATGTGCTCATGAACTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001170.1-820s1c1
Sequence:CCGGCCTTGGCATGAACACAGGATACTCGAGTATCCTGTGTTCATGCCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001170.1-373s1c1
Sequence:CCGGCCTTGGTGTCAACTTGGGTTTCTCGAGAAACCCAAGTTGACACCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001170.1-1032s21c1
Sequence:CCGGTGGAGGATTCTGTGGCGTATGCTCGAGCATACGCCACAGAATCCTCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001170.1-498s21c1
Sequence:CCGGGGAGGAAGTTTCCGGTCTATGCTCGAGCATAGACCGGAAACTTCCTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001170.1-770s21c1
Sequence:CCGGGGAACAGAGGCGCTGGTGATACTCGAGTATCACCAGCGCCTCTGTTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001170.1-966s21c1
Sequence:CCGGCCTATCTAGGTGGCATCATCTCTCGAGAGATGATGCCACCTAGATAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001170
AQP7 MISSION shRNA Lentiviral Transduction Particles
aquaporin 7
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000059693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001170.1-458s1c1
Sequence:CCGGGCTGTGACCTTTGCTAACTGTCTCGAGACAGTTAGCAAAGGTCACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001170.1-1047s1c1
Sequence:CCGGCGTATGAAGACCACGGGATAACTCGAGTTATCCCGTGGTCTTCATACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001170.1-287s1c1
Sequence:CCGGGCCGAGTTCATGAGCACATATCTCGAGATATGTGCTCATGAACTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001170.1-820s1c1
Sequence:CCGGCCTTGGCATGAACACAGGATACTCGAGTATCCTGTGTTCATGCCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001170.1-373s1c1
Sequence:CCGGCCTTGGTGTCAACTTGGGTTTCTCGAGAAACCCAAGTTGACACCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001170.1-1032s21c1
Sequence:CCGGTGGAGGATTCTGTGGCGTATGCTCGAGCATACGCCACAGAATCCTCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001170.1-498s21c1
Sequence:CCGGGGAGGAAGTTTCCGGTCTATGCTCGAGCATAGACCGGAAACTTCCTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001170.1-770s21c1
Sequence:CCGGGGAACAGAGGCGCTGGTGATACTCGAGTATCACCAGCGCCTCTGTTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001170.1-966s21c1
Sequence:CCGGCCTATCTAGGTGGCATCATCTCTCGAGAGATGATGCCACCTAGATAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007473
AQP7 MISSION shRNA Bacterial Glycerol Stock
aquaporin 7
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000102160    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007473.3-1964s1c1
Sequence:CCGGGCCTTGTGTATGCTAGGTAATCTCGAGATTACCTAGCATACACAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007473.3-877s1c1
Sequence:CCGGGCTAGGCATGAACTCCGGATACTCGAGTATCCGGAGTTCATGCCTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007473.3-344s1c1
Sequence:CCGGGCAGAGTTCCTGAGTACCTATCTCGAGATAGGTACTCAGGAACTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007473.3-891s1c1
Sequence:CCGGCCGGATATGCAATCAACCCATCTCGAGATGGGTTGATTGCATATCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007473.3-1111s1c1
Sequence:CCGGCCAGAAGGTAACTGCATCATACTCGAGTATGATGCAGTTACCTTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438027    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007473.4-1569s21c1
Sequence:CCGGACTACCCTGCTTGGCATATTCCTCGAGGAATATGCCAAGCAGGGTAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007473.4-1202s21c1
Sequence:CCGGTATTGTATACCTGGGTTTAATCTCGAGATTAAACCCAGGTATACAATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007473.4-775s21c1
Sequence:CCGGCAGCTACCACCTACTTAATTTCTCGAGAAATTAAGTAGGTGGTAGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007473.4-487s21c1
Sequence:CCGGAGAATATGGTGCGAGAGTTTCCTCGAGGAAACTCTCGCACCATATTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007473
AQP7 MISSION shRNA shRNA Plasmid DNA
aquaporin 7
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000102160    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007473.3-1964s1c1
Sequence:CCGGGCCTTGTGTATGCTAGGTAATCTCGAGATTACCTAGCATACACAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007473.3-877s1c1
Sequence:CCGGGCTAGGCATGAACTCCGGATACTCGAGTATCCGGAGTTCATGCCTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007473.3-344s1c1
Sequence:CCGGGCAGAGTTCCTGAGTACCTATCTCGAGATAGGTACTCAGGAACTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007473.3-891s1c1
Sequence:CCGGCCGGATATGCAATCAACCCATCTCGAGATGGGTTGATTGCATATCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007473.3-1111s1c1
Sequence:CCGGCCAGAAGGTAACTGCATCATACTCGAGTATGATGCAGTTACCTTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438027    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007473.4-1569s21c1
Sequence:CCGGACTACCCTGCTTGGCATATTCCTCGAGGAATATGCCAAGCAGGGTAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007473.4-1202s21c1
Sequence:CCGGTATTGTATACCTGGGTTTAATCTCGAGATTAAACCCAGGTATACAATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007473.4-775s21c1
Sequence:CCGGCAGCTACCACCTACTTAATTTCTCGAGAAATTAAGTAGGTGGTAGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007473.4-487s21c1
Sequence:CCGGAGAATATGGTGCGAGAGTTTCCTCGAGGAAACTCTCGCACCATATTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007473
AQP7 MISSION shRNA Lentiviral Transduction Particles
aquaporin 7
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000102160    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007473.3-1964s1c1
Sequence:CCGGGCCTTGTGTATGCTAGGTAATCTCGAGATTACCTAGCATACACAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007473.3-877s1c1
Sequence:CCGGGCTAGGCATGAACTCCGGATACTCGAGTATCCGGAGTTCATGCCTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007473.3-344s1c1
Sequence:CCGGGCAGAGTTCCTGAGTACCTATCTCGAGATAGGTACTCAGGAACTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007473.3-891s1c1
Sequence:CCGGCCGGATATGCAATCAACCCATCTCGAGATGGGTTGATTGCATATCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007473.3-1111s1c1
Sequence:CCGGCCAGAAGGTAACTGCATCATACTCGAGTATGATGCAGTTACCTTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438027    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007473.4-1569s21c1
Sequence:CCGGACTACCCTGCTTGGCATATTCCTCGAGGAATATGCCAAGCAGGGTAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007473.4-1202s21c1
Sequence:CCGGTATTGTATACCTGGGTTTAATCTCGAGATTAAACCCAGGTATACAATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007473.4-775s21c1
Sequence:CCGGCAGCTACCACCTACTTAATTTCTCGAGAAATTAAGTAGGTGGTAGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007473.4-487s21c1
Sequence:CCGGAGAATATGGTGCGAGAGTTTCCTCGAGGAAACTCTCGCACCATATTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)