EMAIL THIS PAGE TO A FRIEND

AQP8

aquaporin 8

81 Gene Product Result for
Synonyms: AQP-8
UniProtKB ID: O94778, Q8IUU3, Q9UIA4
Gene ID:
Human(343) Summary: Aquaporin 8 (AQP8) is a water channel protein. Aquaporins are a family of small integral membrane proteins related to the major intrinsic protein (MIP or AQP0). Aquaporin 8 mRNA is found in pancreas and colon but not other tissues. [provided by RefSeq, Jul 2008]
Mouse(11833) aquaporin 8
Rat(29172) aquaporin 8
chicken(416566) aquaporin 8
cow(450206) aquaporin 8
dog(608036) aquaporin 8
sheep(101108013) aquaporin 8
sheep(443183) aquaporin 8
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001169 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001169 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001169 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007474 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007474 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007474 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU034911 MISSION® esiRNA esiRNA human AQP8 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001169 Rosetta Predictions human pricing
NM_019158 Rosetta Predictions rat pricing
NM_001109045 Rosetta Predictions mouse pricing
NM_007474 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001169 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00205291 predicted 684
2 SASI_Hs01_00205292 predicted 807
3 SASI_Hs01_00205293 predicted 1044
4 SASI_Hs01_00205294 predicted 478
5 SASI_Hs01_00205296 predicted 386
6 SASI_Hs01_00205298 predicted 745
7 SASI_Hs02_00331291 predicted 752
8 SASI_Hs01_00205299 predicted 584
9 SASI_Hs01_00205300 predicted 833
10 SASI_Hs02_00331292 predicted 983
11 SASI_Hs01_00205295 predicted 1036
12 SASI_Hs01_00205297 predicted 880
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019158 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00060178 predicted 1232
2 SASI_Rn01_00060179 predicted 207
3 SASI_Rn01_00060180 predicted 278
4 SASI_Rn01_00060181 predicted 1139
5 SASI_Rn01_00060182 predicted 956
6 SASI_Rn01_00060184 predicted 835
7 SASI_Rn01_00060185 predicted 891
8 SASI_Rn01_00060186 predicted 1238
9 SASI_Rn01_00060187 predicted 529
10 SASI_Rn02_00261938 predicted 948
11 SASI_Rn01_00060183 predicted 699
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109045 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00304064 predicted 997
2 SASI_Mm02_00304065 predicted 469
3 SASI_Mm02_00304066 predicted 478
4 SASI_Mm02_00304067 predicted 982
5 SASI_Mm02_00304068 predicted 1118
6 SASI_Mm02_00304069 predicted 568
7 SASI_Mm02_00304070 predicted 489
8 SASI_Mm02_00304071 predicted 457
9 SASI_Mm02_00304072 predicted 480
10 SASI_Mm02_00304073 predicted 1231
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007474 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00311718 predicted 994
2 SASI_Mm02_00311719 predicted 470
3 SASI_Mm01_00140268 predicted 485
4 SASI_Mm01_00140269 predicted 984
5 SASI_Mm02_00311720 predicted 1126
6 SASI_Mm02_00311721 predicted 579
7 SASI_Mm02_00311722 predicted 500
8 SASI_Mm02_00311723 predicted 457
9 SASI_Mm02_00311724 predicted 480
10 SASI_Mm02_00311725 predicted 1236
11 SASI_Mm01_00140267 predicted 540
12 SASI_Mm01_00140270 predicted 291
13 SASI_Mm01_00140271 predicted 231
14 SASI_Mm01_00140272 predicted 490
15 SASI_Mm01_00140273 predicted 608
16 SASI_Mm01_00140274 predicted 296
17 SASI_Mm01_00140275 predicted 461
18 SASI_Mm01_00140276 predicted 225
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001169
AQP8 MISSION shRNA Bacterial Glycerol Stock
aquaporin 8
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000439443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001169.2-693s21c1
Sequence:CCGGTGTCTGGAGGCTGCATGAATCCTCGAGGATTCATGCAGCCTCCAGACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001169.2-597s21c1
Sequence:CCGGTATGCATGGGTGCCATCAATGCTCGAGCATTGATGGCACCCATGCATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001169.2-164s21c1
Sequence:CCGGGTGTCCTGGTACGAACGGTTTCTCGAGAAACCGTTCGTACCAGGACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420185    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001169.2-1134s21c1
Sequence:CCGGAGCGTGTTTCTTGAGAGGAATCTCGAGATTCCTCTCAAGAAACACGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001169.2-109s1c1
Sequence:CCGGGCCTGAATTTGGCAATGACAACTCGAGTTGTCATTGCCAAATTCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001169.2-808s1c1
Sequence:CCGGACTGCTCATTAGGTGCTTCATCTCGAGATGAAGCACCTAATGAGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001169.2-334s1c1
Sequence:CCGGGAATATCAGTGGTGGACACTTCTCGAGAAGTGTCCACCACTGATATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001169.2-751s1c1
Sequence:CCGGCTGGAACTTCCACTGGATCTACTCGAGTAGATCCAGTGGAAGTTCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001169.2-214s1c1
Sequence:CCGGCTCTGCTCTCTTCATCTTCATCTCGAGATGAAGATGAAGAGAGCAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001169
AQP8 MISSION shRNA shRNA Plasmid DNA
aquaporin 8
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000439443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001169.2-693s21c1
Sequence:CCGGTGTCTGGAGGCTGCATGAATCCTCGAGGATTCATGCAGCCTCCAGACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001169.2-597s21c1
Sequence:CCGGTATGCATGGGTGCCATCAATGCTCGAGCATTGATGGCACCCATGCATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001169.2-164s21c1
Sequence:CCGGGTGTCCTGGTACGAACGGTTTCTCGAGAAACCGTTCGTACCAGGACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420185    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001169.2-1134s21c1
Sequence:CCGGAGCGTGTTTCTTGAGAGGAATCTCGAGATTCCTCTCAAGAAACACGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001169.2-109s1c1
Sequence:CCGGGCCTGAATTTGGCAATGACAACTCGAGTTGTCATTGCCAAATTCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001169.2-808s1c1
Sequence:CCGGACTGCTCATTAGGTGCTTCATCTCGAGATGAAGCACCTAATGAGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001169.2-334s1c1
Sequence:CCGGGAATATCAGTGGTGGACACTTCTCGAGAAGTGTCCACCACTGATATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001169.2-751s1c1
Sequence:CCGGCTGGAACTTCCACTGGATCTACTCGAGTAGATCCAGTGGAAGTTCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001169.2-214s1c1
Sequence:CCGGCTCTGCTCTCTTCATCTTCATCTCGAGATGAAGATGAAGAGAGCAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001169
AQP8 MISSION shRNA Lentiviral Transduction Particles
aquaporin 8
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000439443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001169.2-693s21c1
Sequence:CCGGTGTCTGGAGGCTGCATGAATCCTCGAGGATTCATGCAGCCTCCAGACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001169.2-597s21c1
Sequence:CCGGTATGCATGGGTGCCATCAATGCTCGAGCATTGATGGCACCCATGCATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001169.2-164s21c1
Sequence:CCGGGTGTCCTGGTACGAACGGTTTCTCGAGAAACCGTTCGTACCAGGACACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420185    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001169.2-1134s21c1
Sequence:CCGGAGCGTGTTTCTTGAGAGGAATCTCGAGATTCCTCTCAAGAAACACGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001169.2-109s1c1
Sequence:CCGGGCCTGAATTTGGCAATGACAACTCGAGTTGTCATTGCCAAATTCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001169.2-808s1c1
Sequence:CCGGACTGCTCATTAGGTGCTTCATCTCGAGATGAAGCACCTAATGAGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001169.2-334s1c1
Sequence:CCGGGAATATCAGTGGTGGACACTTCTCGAGAAGTGTCCACCACTGATATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001169.2-751s1c1
Sequence:CCGGCTGGAACTTCCACTGGATCTACTCGAGTAGATCCAGTGGAAGTTCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001169.2-214s1c1
Sequence:CCGGCTCTGCTCTCTTCATCTTCATCTCGAGATGAAGATGAAGAGAGCAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007474
VALIDATED
AQP8 MISSION shRNA Bacterial Glycerol Stock
aquaporin 8
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000302450    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007474.2-1126s21c1
Sequence:CCGGGCTCCTGGAAACCTGGAATTTCTCGAGAAATTCCAGGTTTCCAGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007474.2-305s21c1
Sequence:CCGGTCGGATGTCTATCGGTCATTGCTCGAGCAATGACCGATAGACATCCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007474.2-643s21c1
Sequence:CCGGCTGACAATGCTGTTGGTATTGCTCGAGCAATACCAACAGCATTGTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007474.2-488s21c1
Sequence:CCGGCCTATTGGATCTCCCAGCTATCTCGAGATAGCTGGGAGATCCAATAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007474.2-867s21c1
Sequence:CCGGCCTCTTTGTAGGACTGCTCATCTCGAGATGAGCAGTCCTACAAAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124209    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007474.1-1108s1c1
Sequence:CCGGGCTCCTGGAAACCTGGAATTTCTCGAGAAATTCCAGGTTTCCAGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007474.1-241s1c1
Sequence:CCGGCAACCATGTATAGTGGAACTTCTCGAGAAGTTCCACTATACATGGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007474.1-470s1c1
Sequence:CCGGCCTATTGGATCTCCCAGCTATCTCGAGATAGCTGGGAGATCCAATAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007474.1-849s1c1
Sequence:CCGGCCTCTTTGTAGGACTGCTCATCTCGAGATGAGCAGTCCTACAAAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007474.1-455s1c1
Sequence:CCGGCCATGCTGCTAATTCCCTATTCTCGAGAATAGGGAATTAGCAGCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007474
VALIDATED
AQP8 MISSION shRNA shRNA Plasmid DNA
aquaporin 8
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000302450    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007474.2-1126s21c1
Sequence:CCGGGCTCCTGGAAACCTGGAATTTCTCGAGAAATTCCAGGTTTCCAGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007474.2-305s21c1
Sequence:CCGGTCGGATGTCTATCGGTCATTGCTCGAGCAATGACCGATAGACATCCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007474.2-643s21c1
Sequence:CCGGCTGACAATGCTGTTGGTATTGCTCGAGCAATACCAACAGCATTGTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007474.2-488s21c1
Sequence:CCGGCCTATTGGATCTCCCAGCTATCTCGAGATAGCTGGGAGATCCAATAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007474.2-867s21c1
Sequence:CCGGCCTCTTTGTAGGACTGCTCATCTCGAGATGAGCAGTCCTACAAAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124209    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007474.1-1108s1c1
Sequence:CCGGGCTCCTGGAAACCTGGAATTTCTCGAGAAATTCCAGGTTTCCAGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007474.1-241s1c1
Sequence:CCGGCAACCATGTATAGTGGAACTTCTCGAGAAGTTCCACTATACATGGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007474.1-470s1c1
Sequence:CCGGCCTATTGGATCTCCCAGCTATCTCGAGATAGCTGGGAGATCCAATAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007474.1-849s1c1
Sequence:CCGGCCTCTTTGTAGGACTGCTCATCTCGAGATGAGCAGTCCTACAAAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007474.1-455s1c1
Sequence:CCGGCCATGCTGCTAATTCCCTATTCTCGAGAATAGGGAATTAGCAGCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007474
VALIDATED
AQP8 MISSION shRNA Lentiviral Transduction Particles
aquaporin 8
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000302450    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007474.2-1126s21c1
Sequence:CCGGGCTCCTGGAAACCTGGAATTTCTCGAGAAATTCCAGGTTTCCAGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007474.2-305s21c1
Sequence:CCGGTCGGATGTCTATCGGTCATTGCTCGAGCAATGACCGATAGACATCCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007474.2-643s21c1
Sequence:CCGGCTGACAATGCTGTTGGTATTGCTCGAGCAATACCAACAGCATTGTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007474.2-488s21c1
Sequence:CCGGCCTATTGGATCTCCCAGCTATCTCGAGATAGCTGGGAGATCCAATAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007474.2-867s21c1
Sequence:CCGGCCTCTTTGTAGGACTGCTCATCTCGAGATGAGCAGTCCTACAAAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124209    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007474.1-1108s1c1
Sequence:CCGGGCTCCTGGAAACCTGGAATTTCTCGAGAAATTCCAGGTTTCCAGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007474.1-241s1c1
Sequence:CCGGCAACCATGTATAGTGGAACTTCTCGAGAAGTTCCACTATACATGGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007474.1-470s1c1
Sequence:CCGGCCTATTGGATCTCCCAGCTATCTCGAGATAGCTGGGAGATCCAATAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007474.1-849s1c1
Sequence:CCGGCCTCTTTGTAGGACTGCTCATCTCGAGATGAGCAGTCCTACAAAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007474.1-455s1c1
Sequence:CCGGCCATGCTGCTAATTCCCTATTCTCGAGAATAGGGAATTAGCAGCATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)