EMAIL THIS PAGE TO A FRIEND

AQP9

aquaporin 9

127 Gene Product Result for
Synonyms: AQP-9 HsT17287 SSC1
UniProtKB ID: O43315, Q9NP32
Gene ID:
Human(366) Summary: The aquaporins are a family of water-selective membrane channels. The protein encoded by this gene allows passage of a wide variety of noncharged solutes. It stimulates urea transport and osmotic water permeability; there are contradicting reports about its role in providing glycerol permeability. The encoded protein may also play a role in specialized leukocyte functions such as immunological response and bactericidal activity. [provided by RefSeq, Jul 2008]
Mouse(64008) aquaporin 9
Rat(65054) aquaporin 9
chicken(415402) aquaporin 9
dog(487576) aquaporin 9
cow(516762) aquaporin 9
sheep(443184) aquaporin 9
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4301752 Anti-AQP9 affinity isolated antibody human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022026 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_022026 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_022026 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020980 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020980 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020980 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020980 Rosetta Predictions human pricing
NM_022960 Rosetta Predictions rat pricing
NM_022026 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020980 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00191327 predicted 1134
2 SASI_Hs02_00354428 predicted 1179
3 SASI_Hs01_00191328 predicted 524
4 SASI_Hs01_00191329 predicted 1196
5 SASI_Hs02_00354429 predicted 873
6 SASI_Hs01_00191330 predicted 628
7 SASI_Hs01_00191331 predicted 635
8 SASI_Hs01_00191332 predicted 418
9 SASI_Hs01_00191333 predicted 1069
10 SASI_Hs01_00191335 predicted 1116
11 SASI_Hs01_00191326 predicted 371
12 SASI_Hs01_00191334 predicted 810
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022960 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00101443 predicted 1164
2 SASI_Rn01_00101444 predicted 1360
3 SASI_Rn01_00101445 predicted 668
4 SASI_Rn01_00101446 predicted 556
5 SASI_Rn01_00101447 predicted 700
6 SASI_Rn01_00101448 predicted 1208
7 SASI_Rn02_00263699 predicted 1381
8 SASI_Rn01_00101449 predicted 813
9 SASI_Rn01_00101450 predicted 1390
10 SASI_Rn01_00101451 predicted 962
11 SASI_Rn01_00101452 predicted 1183
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022026 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00166701 predicted 1265
2 SASI_Mm01_00166702 predicted 702
3 SASI_Mm02_00326502 predicted 1382
4 SASI_Mm01_00166704 predicted 791
5 SASI_Mm01_00166705 predicted 806
6 SASI_Mm01_00166706 predicted 446
7 SASI_Mm01_00166707 predicted 1280
8 SASI_Mm01_00166708 predicted 781
9 SASI_Mm02_00326503 predicted 922
10 SASI_Mm01_00166710 predicted 725
11 SASI_Mm01_00166703 predicted 1122
12 SASI_Mm01_00166709 predicted 927
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022026
VALIDATED
AQP9 MISSION shRNA Bacterial Glycerol Stock
aquaporin 9
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000119592    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022026.2-2283s1c1
Sequence:CCGGGCCGTTTGATAATGTTCATTTCTCGAGAAATGAACATTATCAAACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022026.2-413s1c1
Sequence:CCGGGATGGCTCTTTATGCGACTTTCTCGAGAAAGTCGCATAAAGAGCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022026.2-368s1c1
Sequence:CCGGTGGTGGGATCATCACTATCAACTCGAGTTGATAGTGATGATCCCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022026.2-722s1c1
Sequence:CCGGCCTTCTGATTGTCTTTGCCATCTCGAGATGGCAAAGACAATCAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022026.2-1047s1c1
Sequence:CCGGCCAGCCGAGAACAATCTAGAACTCGAGTTCTAGATTGTTCTCGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000354212    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022026.2-2283s21c1
Sequence:CCGGGCCGTTTGATAATGTTCATTTCTCGAGAAATGAACATTATCAAACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022026.2-1047s21c1
Sequence:CCGGCCAGCCGAGAACAATCTAGAACTCGAGTTCTAGATTGTTCTCGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022026.2-368s21c1
Sequence:CCGGTGGTGGGATCATCACTATCAACTCGAGTTGATAGTGATGATCCCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022026.2-413s21c1
Sequence:CCGGGATGGCTCTTTATGCGACTTTCTCGAGAAAGTCGCATAAAGAGCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022026
VALIDATED
AQP9 MISSION shRNA shRNA Plasmid DNA
aquaporin 9
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000119592    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022026.2-2283s1c1
Sequence:CCGGGCCGTTTGATAATGTTCATTTCTCGAGAAATGAACATTATCAAACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022026.2-413s1c1
Sequence:CCGGGATGGCTCTTTATGCGACTTTCTCGAGAAAGTCGCATAAAGAGCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022026.2-368s1c1
Sequence:CCGGTGGTGGGATCATCACTATCAACTCGAGTTGATAGTGATGATCCCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022026.2-722s1c1
Sequence:CCGGCCTTCTGATTGTCTTTGCCATCTCGAGATGGCAAAGACAATCAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022026.2-1047s1c1
Sequence:CCGGCCAGCCGAGAACAATCTAGAACTCGAGTTCTAGATTGTTCTCGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000354212    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022026.2-2283s21c1
Sequence:CCGGGCCGTTTGATAATGTTCATTTCTCGAGAAATGAACATTATCAAACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022026.2-1047s21c1
Sequence:CCGGCCAGCCGAGAACAATCTAGAACTCGAGTTCTAGATTGTTCTCGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022026.2-368s21c1
Sequence:CCGGTGGTGGGATCATCACTATCAACTCGAGTTGATAGTGATGATCCCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022026.2-413s21c1
Sequence:CCGGGATGGCTCTTTATGCGACTTTCTCGAGAAAGTCGCATAAAGAGCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022026
VALIDATED
AQP9 MISSION shRNA Lentiviral Transduction Particles
aquaporin 9
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000119592    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022026.2-2283s1c1
Sequence:CCGGGCCGTTTGATAATGTTCATTTCTCGAGAAATGAACATTATCAAACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022026.2-413s1c1
Sequence:CCGGGATGGCTCTTTATGCGACTTTCTCGAGAAAGTCGCATAAAGAGCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022026.2-368s1c1
Sequence:CCGGTGGTGGGATCATCACTATCAACTCGAGTTGATAGTGATGATCCCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022026.2-722s1c1
Sequence:CCGGCCTTCTGATTGTCTTTGCCATCTCGAGATGGCAAAGACAATCAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022026.2-1047s1c1
Sequence:CCGGCCAGCCGAGAACAATCTAGAACTCGAGTTCTAGATTGTTCTCGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000354212    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022026.2-2283s21c1
Sequence:CCGGGCCGTTTGATAATGTTCATTTCTCGAGAAATGAACATTATCAAACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022026.2-1047s21c1
Sequence:CCGGCCAGCCGAGAACAATCTAGAACTCGAGTTCTAGATTGTTCTCGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022026.2-368s21c1
Sequence:CCGGTGGTGGGATCATCACTATCAACTCGAGTTGATAGTGATGATCCCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022026.2-413s21c1
Sequence:CCGGGATGGCTCTTTATGCGACTTTCTCGAGAAAGTCGCATAAAGAGCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020980
AQP9 MISSION shRNA Bacterial Glycerol Stock
aquaporin 9
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000155560    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020980.2-874s1c1
Sequence:CCGGCGGCCTCCTGATTATTGTCATCTCGAGATGACAATAATCAGGAGGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020980.2-761s1c1
Sequence:CCGGGCGAACGCATTTGCAGATCAACTCGAGTTGATCTGCAAATGCGTTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151033    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020980.2-2280s1c1
Sequence:CCGGGCACACTGAAAGTTGAATGTTCTCGAGAACATTCAACTTTCAGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151387    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020980.2-1133s1c1
Sequence:CCGGGAGGACAAACCAGAGAAATATCTCGAGATATTTCTCTGGTTTGTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151486    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020980.2-1076s1c1
Sequence:CCGGCTTGTCATTGAAATCCACCATCTCGAGATGGTGGATTTCAATGACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151799    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020980.2-803s1c1
Sequence:CCGGCTCATAATCGTCTTTGCCATTCTCGAGAATGGCAAAGACGATTATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151947    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020980.2-1421s1c1
Sequence:CCGGCCTGTTTATTTCATCCTCGATCTCGAGATCGAGGATGAAATAAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152808    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020980.2-542s1c1
Sequence:CCGGGCTGTGTCTTTAGCAATGTGTCTCGAGACACATTGCTAAAGACACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020980.2-1121s1c1
Sequence:CCGGGCAGAACAATCTGAGGACAAACTCGAGTTTGTCCTCAGATTGTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154828    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020980.2-1186s1c1
Sequence:CCGGGCTCTGGATTTGCAGTCAGTTCTCGAGAACTGACTGCAAATCCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020980
AQP9 MISSION shRNA shRNA Plasmid DNA
aquaporin 9
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000155560    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020980.2-874s1c1
Sequence:CCGGCGGCCTCCTGATTATTGTCATCTCGAGATGACAATAATCAGGAGGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020980.2-761s1c1
Sequence:CCGGGCGAACGCATTTGCAGATCAACTCGAGTTGATCTGCAAATGCGTTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151033    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020980.2-2280s1c1
Sequence:CCGGGCACACTGAAAGTTGAATGTTCTCGAGAACATTCAACTTTCAGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151387    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020980.2-1133s1c1
Sequence:CCGGGAGGACAAACCAGAGAAATATCTCGAGATATTTCTCTGGTTTGTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151486    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020980.2-1076s1c1
Sequence:CCGGCTTGTCATTGAAATCCACCATCTCGAGATGGTGGATTTCAATGACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151799    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020980.2-803s1c1
Sequence:CCGGCTCATAATCGTCTTTGCCATTCTCGAGAATGGCAAAGACGATTATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151947    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020980.2-1421s1c1
Sequence:CCGGCCTGTTTATTTCATCCTCGATCTCGAGATCGAGGATGAAATAAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152808    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020980.2-542s1c1
Sequence:CCGGGCTGTGTCTTTAGCAATGTGTCTCGAGACACATTGCTAAAGACACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020980.2-1121s1c1
Sequence:CCGGGCAGAACAATCTGAGGACAAACTCGAGTTTGTCCTCAGATTGTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154828    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020980.2-1186s1c1
Sequence:CCGGGCTCTGGATTTGCAGTCAGTTCTCGAGAACTGACTGCAAATCCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020980
AQP9 MISSION shRNA Lentiviral Transduction Particles
aquaporin 9
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000155560    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020980.2-874s1c1
Sequence:CCGGCGGCCTCCTGATTATTGTCATCTCGAGATGACAATAATCAGGAGGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020980.2-761s1c1
Sequence:CCGGGCGAACGCATTTGCAGATCAACTCGAGTTGATCTGCAAATGCGTTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151033    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020980.2-2280s1c1
Sequence:CCGGGCACACTGAAAGTTGAATGTTCTCGAGAACATTCAACTTTCAGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151387    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020980.2-1133s1c1
Sequence:CCGGGAGGACAAACCAGAGAAATATCTCGAGATATTTCTCTGGTTTGTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151486    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020980.2-1076s1c1
Sequence:CCGGCTTGTCATTGAAATCCACCATCTCGAGATGGTGGATTTCAATGACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151799    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020980.2-803s1c1
Sequence:CCGGCTCATAATCGTCTTTGCCATTCTCGAGAATGGCAAAGACGATTATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151947    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020980.2-1421s1c1
Sequence:CCGGCCTGTTTATTTCATCCTCGATCTCGAGATCGAGGATGAAATAAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152808    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020980.2-542s1c1
Sequence:CCGGGCTGTGTCTTTAGCAATGTGTCTCGAGACACATTGCTAAAGACACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020980.2-1121s1c1
Sequence:CCGGGCAGAACAATCTGAGGACAAACTCGAGTTTGTCCTCAGATTGTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154828    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020980.2-1186s1c1
Sequence:CCGGGCTCTGGATTTGCAGTCAGTTCTCGAGAACTGACTGCAAATCCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks