EMAIL THIS PAGE TO A FRIEND

AQPEP

133 Gene Product Result for
Synonyms: APQ LVRN
Gene ID:
Rat(502160) laeverin
dog(481434) laeverin
cow(525695) laeverin
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173800 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173800 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173800 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU015481 MISSION® esiRNA esiRNA targeting human LVRN (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173800 Rosetta Predictions human pricing
XM_001054995 Rosetta Predictions rat pricing
XM_577617 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173800 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00244555 predicted 2288
2 SASI_Hs02_00368654 predicted 981
3 SASI_Hs01_00244556 predicted 2256
4 SASI_Hs01_00244559 predicted 1203
5 SASI_Hs01_00244560 predicted 1689
6 SASI_Hs01_00244561 predicted 1105
7 SASI_Hs02_00368655 predicted 2238
8 SASI_Hs01_00244562 predicted 1560
9 SASI_Hs01_00244563 predicted 2652
10 SASI_Hs02_00368656 predicted 1868
11 SASI_Hs01_00244554 predicted 2846
12 SASI_Hs01_00244557 predicted 1856
13 SASI_Hs01_00244558 predicted 848
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001054995 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00277986 predicted 2266
2 SASI_Rn02_00277987 predicted 581
3 SASI_Rn02_00277988 predicted 2629
4 SASI_Rn02_00277989 predicted 1852
5 SASI_Rn02_00277990 predicted 787
6 SASI_Rn02_00277991 predicted 1051
7 SASI_Rn02_00277992 predicted 2257
8 SASI_Rn02_00277993 predicted 2490
9 SASI_Rn02_00277994 predicted 905
10 SASI_Rn02_00277995 predicted 2222
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_577617 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00406844 predicted 2269
2 SASI_Rn02_00406845 predicted 589
3 SASI_Rn02_00406846 predicted 2626
4 SASI_Rn02_00406847 predicted 1852
5 SASI_Rn02_00406848 predicted 796
6 SASI_Rn02_00406849 predicted 1055
7 SASI_Rn02_00406850 predicted 2250
8 SASI_Rn02_00406851 predicted 2483
9 SASI_Rn02_00406852 predicted 902
10 SASI_Rn02_00406853 predicted 2218
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173800
AQPEP MISSION shRNA Bacterial Glycerol Stock
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000073853    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173800.3-3969s1c1
Sequence:CCGGGCCAAATTGAACCTACTTGTACTCGAGTACAAGTAGGTTCAATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173800.3-1936s1c1
Sequence:CCGGGCAGCAAAGTATTCCCAGAAACTCGAGTTTCTGGGAATACTTTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173800.3-1037s1c1
Sequence:CCGGCCGGAAAGATGCAATTGCAAACTCGAGTTTGCAATTGCATCTTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173800.3-968s1c1
Sequence:CCGGCGCATTTGTTATATGTGACTACTCGAGTAGTCACATATAACAAATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173800.3-1574s1c1
Sequence:CCGGCCGGATGCTTTCTTGTTTCTTCTCGAGAAGAAACAAGAAAGCATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173800
AQPEP MISSION shRNA shRNA Plasmid DNA
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000073853    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173800.3-3969s1c1
Sequence:CCGGGCCAAATTGAACCTACTTGTACTCGAGTACAAGTAGGTTCAATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173800.3-1936s1c1
Sequence:CCGGGCAGCAAAGTATTCCCAGAAACTCGAGTTTCTGGGAATACTTTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173800.3-1037s1c1
Sequence:CCGGCCGGAAAGATGCAATTGCAAACTCGAGTTTGCAATTGCATCTTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173800.3-968s1c1
Sequence:CCGGCGCATTTGTTATATGTGACTACTCGAGTAGTCACATATAACAAATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173800.3-1574s1c1
Sequence:CCGGCCGGATGCTTTCTTGTTTCTTCTCGAGAAGAAACAAGAAAGCATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173800
AQPEP MISSION shRNA Lentiviral Transduction Particles
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000073853    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173800.3-3969s1c1
Sequence:CCGGGCCAAATTGAACCTACTTGTACTCGAGTACAAGTAGGTTCAATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173800.3-1936s1c1
Sequence:CCGGGCAGCAAAGTATTCCCAGAAACTCGAGTTTCTGGGAATACTTTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173800.3-1037s1c1
Sequence:CCGGCCGGAAAGATGCAATTGCAAACTCGAGTTTGCAATTGCATCTTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173800.3-968s1c1
Sequence:CCGGCGCATTTGTTATATGTGACTACTCGAGTAGTCACATATAACAAATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173800.3-1574s1c1
Sequence:CCGGCCGGATGCTTTCTTGTTTCTTCTCGAGAAGAAACAAGAAAGCATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks