EMAIL THIS PAGE TO A FRIEND

AQR

aquarius intron-binding spliceosomal factor

70 Gene Product Result for
Synonyms: IBP160 fSAP164
UniProtKB ID: O60306, A0JP17, A5YKK3, Q2YDX9, Q6IRU8, Q6PIC8
Gene ID:
Mouse(11834) aquarius
Rat(366163) aquarius homolog (mouse)
domestic guinea pig(100726222) aquarius homolog (mouse)
naked mole-rat(101724261) aquarius homolog (mouse)
sheep(101103571) aquarius homolog (mouse)
Domestic Rabbit(100340085) aquarius homolog (mouse)
Zebrafish(393436) aquarius homolog (mouse)
cow(537445) aquarius homolog (mouse)
Horse(100057637) aquarius homolog (mouse)
domestic cat(101095344) aquarius homolog (mouse)
dog(478251) aquarius homolog (mouse)
chicken(423296) aquarius homolog (mouse)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014691 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014691 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014691 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009702 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009702 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009702 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014691 Rosetta Predictions human pricing
NM_001100987 Rosetta Predictions rat pricing
NM_009702 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014691 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00207564 predicted 1669
2 SASI_Hs01_00207565 predicted 4298
3 SASI_Hs01_00207566 predicted 722
4 SASI_Hs01_00207567 predicted 647
5 SASI_Hs02_00346068 predicted 2701
6 SASI_Hs01_00207568 predicted 4177
7 SASI_Hs02_00346069 predicted 843
8 SASI_Hs01_00207569 predicted 3558
9 SASI_Hs01_00207571 predicted 3323
10 SASI_Hs01_00207572 predicted 2743
11 SASI_Hs01_00207570 predicted 910
12 SASI_Hs01_00207573 predicted 3316
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100987 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00211012 predicted 4019
2 SASI_Rn02_00211013 predicted 3387
3 SASI_Rn02_00211014 predicted 3734
4 SASI_Rn02_00211015 predicted 2800
5 SASI_Rn02_00211016 predicted 2023
6 SASI_Rn02_00211017 predicted 3862
7 SASI_Rn02_00211018 predicted 4615
8 SASI_Rn02_00211019 predicted 2232
9 SASI_Rn02_00211020 predicted 879
10 SASI_Rn02_00211021 predicted 659
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009702 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00054986 predicted 1593
2 SASI_Mm01_00054987 predicted 913
3 SASI_Mm01_00054988 predicted 2851
4 SASI_Mm01_00054989 predicted 1780
5 SASI_Mm01_00054990 predicted 3790
6 SASI_Mm01_00054991 predicted 1155
7 SASI_Mm01_00054992 predicted 3382
8 SASI_Mm01_00054993 predicted 4652
9 SASI_Mm01_00054994 predicted 3330
10 SASI_Mm01_00054995 predicted 1658
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014691
VALIDATED
AQR MISSION shRNA Bacterial Glycerol Stock
aquarius intron-binding spliceosomal factor
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000074868    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_014691.2-4845s1c1
Sequence:CCGGGCAAATAACCATTCCTTTCATCTCGAGATGAAAGGAATGGTTATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_014691.2-2310s1c1
Sequence:CCGGCCACCCTTGATTTCAATGATACTCGAGTATCATTGAAATCAAGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_014691.2-902s1c1
Sequence:CCGGCCTGTCACTATGGACAAAGTTCTCGAGAACTTTGTCCATAGTGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_014691.2-1787s1c1
Sequence:CCGGCGTGCAGATGTTACCATAAATCTCGAGATTTATGGTAACATCTGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_014691.2-3334s1c1
Sequence:CCGGGCTAGGTTTCAAGTATGACAACTCGAGTTGTCATACTTGAAACCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377461    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014691.2-4772s21c1
Sequence:CCGGTTTCGGTGTCTTGAATATATTCTCGAGAATATATTCAAGACACCGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_014691.2-1407s21c1
Sequence:CCGGCTCGTCATGAACGTCGAATTTCTCGAGAAATTCGACGTTCATGACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_014691.2-434s21c1
Sequence:CCGGGTATCTAGCAAGGCCTATTTACTCGAGTAAATAGGCCTTGCTAGATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312603    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_014691.2-4886s21c1
Sequence:CCGGCTGTAATCATACCTACATTAACTCGAGTTAATGTAGGTATGATTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014691.2-3334s21c1
Sequence:CCGGGCTAGGTTTCAAGTATGACAACTCGAGTTGTCATACTTGAAACCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_014691.2-1598s21c1
Sequence:CCGGTTCCGCTTAGAATCAACTTATCTCGAGATAAGTTGATTCTAAGCGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014691
VALIDATED
AQR MISSION shRNA shRNA Plasmid DNA
aquarius intron-binding spliceosomal factor
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000074868    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_014691.2-4845s1c1
Sequence:CCGGGCAAATAACCATTCCTTTCATCTCGAGATGAAAGGAATGGTTATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_014691.2-2310s1c1
Sequence:CCGGCCACCCTTGATTTCAATGATACTCGAGTATCATTGAAATCAAGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_014691.2-902s1c1
Sequence:CCGGCCTGTCACTATGGACAAAGTTCTCGAGAACTTTGTCCATAGTGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_014691.2-1787s1c1
Sequence:CCGGCGTGCAGATGTTACCATAAATCTCGAGATTTATGGTAACATCTGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_014691.2-3334s1c1
Sequence:CCGGGCTAGGTTTCAAGTATGACAACTCGAGTTGTCATACTTGAAACCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377461    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014691.2-4772s21c1
Sequence:CCGGTTTCGGTGTCTTGAATATATTCTCGAGAATATATTCAAGACACCGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_014691.2-1407s21c1
Sequence:CCGGCTCGTCATGAACGTCGAATTTCTCGAGAAATTCGACGTTCATGACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_014691.2-434s21c1
Sequence:CCGGGTATCTAGCAAGGCCTATTTACTCGAGTAAATAGGCCTTGCTAGATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312603    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_014691.2-4886s21c1
Sequence:CCGGCTGTAATCATACCTACATTAACTCGAGTTAATGTAGGTATGATTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014691.2-3334s21c1
Sequence:CCGGGCTAGGTTTCAAGTATGACAACTCGAGTTGTCATACTTGAAACCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_014691.2-1598s21c1
Sequence:CCGGTTCCGCTTAGAATCAACTTATCTCGAGATAAGTTGATTCTAAGCGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014691
VALIDATED
AQR MISSION shRNA Lentiviral Transduction Particles
aquarius intron-binding spliceosomal factor
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000074868    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_014691.2-4845s1c1
Sequence:CCGGGCAAATAACCATTCCTTTCATCTCGAGATGAAAGGAATGGTTATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_014691.2-2310s1c1
Sequence:CCGGCCACCCTTGATTTCAATGATACTCGAGTATCATTGAAATCAAGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_014691.2-902s1c1
Sequence:CCGGCCTGTCACTATGGACAAAGTTCTCGAGAACTTTGTCCATAGTGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_014691.2-1787s1c1
Sequence:CCGGCGTGCAGATGTTACCATAAATCTCGAGATTTATGGTAACATCTGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_014691.2-3334s1c1
Sequence:CCGGGCTAGGTTTCAAGTATGACAACTCGAGTTGTCATACTTGAAACCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377461    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014691.2-4772s21c1
Sequence:CCGGTTTCGGTGTCTTGAATATATTCTCGAGAATATATTCAAGACACCGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_014691.2-1407s21c1
Sequence:CCGGCTCGTCATGAACGTCGAATTTCTCGAGAAATTCGACGTTCATGACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_014691.2-434s21c1
Sequence:CCGGGTATCTAGCAAGGCCTATTTACTCGAGTAAATAGGCCTTGCTAGATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312603    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_014691.2-4886s21c1
Sequence:CCGGCTGTAATCATACCTACATTAACTCGAGTTAATGTAGGTATGATTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014691.2-3334s21c1
Sequence:CCGGGCTAGGTTTCAAGTATGACAACTCGAGTTGTCATACTTGAAACCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_014691.2-1598s21c1
Sequence:CCGGTTCCGCTTAGAATCAACTTATCTCGAGATAAGTTGATTCTAAGCGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009702
VALIDATED
AQR MISSION shRNA Bacterial Glycerol Stock
aquarius intron-binding spliceosomal factor
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000123834    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009702.1-4615s1c1
Sequence:CCGGGCCTGGGACATTCCATTTATACTCGAGTATAAATGGAATGTCCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009702.1-3826s1c1
Sequence:CCGGGCAGACAAGATCAGTATTCTACTCGAGTAGAATACTGATCTTGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009702.1-796s1c1
Sequence:CCGGGCCTACCAAGAAAGAAGGTTTCTCGAGAAACCTTCTTTCTTGGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009702.1-4144s1c1
Sequence:CCGGCCACTGCATTTGCATATCATTCTCGAGAATGATATGCAAATGCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009702.1-3422s1c1
Sequence:CCGGGCCGATTGAAACGGTGGATTACTCGAGTAATCCACCGTTTCAATCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009702.2-3846s21c1
Sequence:CCGGGCAGACAAGATCAGTATTCTACTCGAGTAGAATACTGATCTTGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327191    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009702.2-4635s21c1
Sequence:CCGGGCCTGGGACATTCCATTTATACTCGAGTATAAATGGAATGTCCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009702.2-3442s21c1
Sequence:CCGGGCCGATTGAAACGGTGGATTACTCGAGTAATCCACCGTTTCAATCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009702.2-4164s21c1
Sequence:CCGGCCACTGCATTTGCATATCATTCTCGAGAATGATATGCAAATGCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009702.2-816s21c1
Sequence:CCGGGCCTACCAAGAAAGAAGGTTTCTCGAGAAACCTTCTTTCTTGGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009702
VALIDATED
AQR MISSION shRNA shRNA Plasmid DNA
aquarius intron-binding spliceosomal factor
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000123834    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009702.1-4615s1c1
Sequence:CCGGGCCTGGGACATTCCATTTATACTCGAGTATAAATGGAATGTCCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009702.1-3826s1c1
Sequence:CCGGGCAGACAAGATCAGTATTCTACTCGAGTAGAATACTGATCTTGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009702.1-796s1c1
Sequence:CCGGGCCTACCAAGAAAGAAGGTTTCTCGAGAAACCTTCTTTCTTGGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009702.1-4144s1c1
Sequence:CCGGCCACTGCATTTGCATATCATTCTCGAGAATGATATGCAAATGCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009702.1-3422s1c1
Sequence:CCGGGCCGATTGAAACGGTGGATTACTCGAGTAATCCACCGTTTCAATCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009702.2-3846s21c1
Sequence:CCGGGCAGACAAGATCAGTATTCTACTCGAGTAGAATACTGATCTTGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327191    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009702.2-4635s21c1
Sequence:CCGGGCCTGGGACATTCCATTTATACTCGAGTATAAATGGAATGTCCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009702.2-3442s21c1
Sequence:CCGGGCCGATTGAAACGGTGGATTACTCGAGTAATCCACCGTTTCAATCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009702.2-4164s21c1
Sequence:CCGGCCACTGCATTTGCATATCATTCTCGAGAATGATATGCAAATGCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009702.2-816s21c1
Sequence:CCGGGCCTACCAAGAAAGAAGGTTTCTCGAGAAACCTTCTTTCTTGGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009702
VALIDATED
AQR MISSION shRNA Lentiviral Transduction Particles
aquarius intron-binding spliceosomal factor
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000123834    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009702.1-4615s1c1
Sequence:CCGGGCCTGGGACATTCCATTTATACTCGAGTATAAATGGAATGTCCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009702.1-3826s1c1
Sequence:CCGGGCAGACAAGATCAGTATTCTACTCGAGTAGAATACTGATCTTGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009702.1-796s1c1
Sequence:CCGGGCCTACCAAGAAAGAAGGTTTCTCGAGAAACCTTCTTTCTTGGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009702.1-4144s1c1
Sequence:CCGGCCACTGCATTTGCATATCATTCTCGAGAATGATATGCAAATGCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009702.1-3422s1c1
Sequence:CCGGGCCGATTGAAACGGTGGATTACTCGAGTAATCCACCGTTTCAATCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009702.2-3846s21c1
Sequence:CCGGGCAGACAAGATCAGTATTCTACTCGAGTAGAATACTGATCTTGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327191    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009702.2-4635s21c1
Sequence:CCGGGCCTGGGACATTCCATTTATACTCGAGTATAAATGGAATGTCCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009702.2-3442s21c1
Sequence:CCGGGCCGATTGAAACGGTGGATTACTCGAGTAATCCACCGTTTCAATCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009702.2-4164s21c1
Sequence:CCGGCCACTGCATTTGCATATCATTCTCGAGAATGATATGCAAATGCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009702.2-816s21c1
Sequence:CCGGGCCTACCAAGAAAGAAGGTTTCTCGAGAAACCTTCTTTCTTGGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks