EMAIL THIS PAGE TO A FRIEND

AR

androgen receptor

285 Gene Product Result for
Synonyms: AIS DHTR HUMARA HYSP1 KD NR3C4 SBMA SMAX1 TFM
UniProtKB ID: P10275, A2RUN2, B1AKD7, Q9UD95
Gene ID:
Human(367) Summary: The androgen receptor gene is more than 90 kb long and codes for a protein that has 3 major functional domains: the N-terminal domain, DNA-binding domain, and androgen-binding domain. The protein functions as a steroid-hormone activated transcription factor. Upon binding the hormone ligand, the receptor dissociates from accessory proteins, translocates into the nucleus, dimerizes, and then stimulates transcription of androgen responsive genes. This gene contains 2 polymorphic trinucleotide repeat segments that encode polyglutamine and polyglycine tracts in the N-terminal transactivation domain of its protein. Expansion of the polyglutamine tract causes spinal bulbar muscular atrophy (Kennedy disease). Mutations in this gene are also associated with complete androgen insensitivity (CAIS). Two alternatively spliced variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2008]
Mouse(11835) androgen receptor
Rat(24208) androgen receptor
Zebrafish(100005148) androgen receptor
chicken(422165) androgen receptor
fruit fly(44503) abdomen rotatum
domestic cat(101081787) androgen receptor
cow(280675) androgen receptor
Horse(100033980) androgen receptor
domestic cat(751827) androgen receptor
dog(403588) androgen receptor
Goat(100860827) androgen receptor
Domestic Rabbit(100009193) androgen receptor
sheep(443042) androgen receptor
domestic guinea pig(100726891) androgen receptor
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1306176 ANTI-ANDROGEN RECEPTOR (ANDR) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, human
immunohistochemistry, western blot pricing
SAB5500007 Anti-Androgen Receptor (C-term) antibody, Rabbit monoclonal recombinant, expressed in proprietary host, clone SP242, affinity isolated antibody human (tested)
immunohistochemistry pricing
SAB2500068 Anti-Androgen Receptor antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
A9853 Anti-Androgen Receptor antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, rat
immunohistochemistry, immunoprecipitation, microarray, western blot pricing
SAB4501575 Anti-Androgen Receptor antibody produced in rabbit affinity isolated antibody human
ELISA, immunohistochemistry, western blot pricing
SAB4501576 Anti-Androgen Receptor antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, western blot pricing
SAB5500006 Anti-Androgen Receptor antibody, Rabbit monoclonal recombinant, expressed in proprietary host, clone SP107, affinity isolated antibody human (tested)
immunohistochemistry pricing
SAB4501574 Anti-Androgen Receptor, N-Terminal antibody produced in rabbit affinity isolated antibody mouse, human
ELISA, immunofluorescence, immunohistochemistry pricing
SAB4300382 Anti-AR (Ab-650) antibody produced in rabbit affinity isolated antibody mouse, human
western blot pricing
SAB2100139 Anti-AR antibody produced in rabbit affinity isolated antibody rabbit, rat, guinea pig, human, sheep, canine, mouse, pig, horse
western blot pricing
HPA065701 Anti-AR antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
SAB4504335 Anti-phospho-Androgen Receptor (pSer650) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunohistochemistry pricing
SAB4504652 Anti-phospho-Androgen Receptor (pTyr363) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, western blot pricing
SAB4301320 Anti-phospho-Androgen Receptor (pTyr363) antibody produced in rabbit affinity isolated antibody mouse, human
western blot pricing
SAB4300098 Anti-phospho-AR (pSer213) antibody produced in rabbit affinity isolated antibody human
immunofluorescence, western blot pricing
SAB4300099 Anti-phospho-AR (pSer650) antibody produced in rabbit affinity isolated antibody human
immunohistochemistry pricing
SAB1305524 MONOCLONAL ANTI-ANDROGEN RECEPTOR PROTEIN antibody produced in mouse clone 549CT16.1.4, purified immunoglobulin, buffered aqueous solution human
western blot pricing
WH0000367M1 Monoclonal Anti-AR antibody produced in mouse clone 1G3, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB5300341 Monoclonal Anti-AR antibody produced in mouse clone 1A9D12, ascites fluid human
ELISA, western blot pricing
SAB5300342 Monoclonal Anti-AR antibody produced in mouse clone 2H8, ascites fluid human
ELISA, immunohistochemistry, western blot pricing

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
N8534 Nilutamide solid human pricing
860417 Salicylamide 99% human pricing
A8380 5α-Androstan-17β-ol-3-one ≥97.5% human, mouse, rat pricing
31573 5α-Androstan-17β-ol-3-one VETRANAL, analytical standard human, mouse, rat pricing
E8875 β-Estradiol ≥98% human, mouse, rat pricing
E2758 β-Estradiol BioReagent, powder, suitable for cell culture human, mouse, rat pricing
E2257 β-Estradiol powder, γ-irradiated, suitable for cell culture human, mouse, rat pricing
E1132 β-Estradiol analytical standard human, mouse, rat pricing
B7005 Betamethasone ≥98% human, mouse, rat pricing
34166 Betamethasone VETRANAL, analytical standard human, mouse, rat pricing
B9675 Betamethasone meets USP testing specifications human, mouse, rat pricing
27883 Coumestrol BioReagent, suitable for fluorescence, ≥97.5% (HPLC) human, mouse, rat pricing
27885 Coumestrol ≥95.0% (HPLC) human, mouse, rat pricing
C3412 Cyproterone acetate ≥98% human, mouse, rat pricing
D1756 Dexamethasone ≥98% (HPLC), powder human, mouse, rat pricing
D4902 Dexamethasone powder, BioReagent, suitable for cell culture, ≥97% human, mouse, rat pricing
D8893 Dexamethasone powder, γ-irradiated, BioXtra, suitable for cell culture, ≥80% (HPLC) human, mouse, rat pricing
D9184 Dexamethasone meets USP testing specifications human, mouse, rat pricing
46165 Dexamethasone VETRANAL, analytical standard human, mouse, rat pricing
31375 Dexamethasone tested according to Ph.Eur. human, mouse, rat pricing
D4628 Diethylstilbestrol ≥99% (HPLC) human, mouse, rat pricing
46207 Diethylstilbestrol VETRANAL, analytical standard human, mouse, rat pricing
218944 Diethylstilbestrol, mixture of cis and trans 97% human, mouse, rat pricing
E1024 Estradiol meets USP testing specifications human, mouse, rat pricing
E1253 Estriol ≥97% human, mouse, rat pricing
E1149 Estriol meets USP testing specifications human, mouse, rat pricing
46565 Estriol VETRANAL, analytical standard human, mouse, rat pricing
102032 Flavanone 98% human, mouse, rat pricing
F2003 Flavone human, mouse, rat pricing
G6649 Genistein synthetic, ≥98% (HPLC), powder human, mouse, rat pricing
G6776 Genistein from Glycine max (soybean), ~98% (HPLC) human, mouse, rat pricing
H4001 Hydrocortisone ≥98% (HPLC) human, mouse, rat pricing
H0135 Hydrocortisone γ-irradiated, powder, BioXtra, suitable for cell culture human, mouse, rat pricing
H0888 Hydrocortisone BioReagent, suitable for cell culture human, mouse, rat pricing
H3160 Hydrocortisone meets USP testing specifications human, mouse, rat pricing
H6909 Hydrocortisone solution 50 μM, sterile-filtered, BioXtra, suitable for cell culture human, mouse, rat pricing
H0396 Hydrocortisone-Water Soluble BioReagent, suitable for cell culture human, mouse, rat pricing
M8046 Mifepristone ≥98% human, mouse, rat pricing
P6004 Prednisolone ≥99% human, mouse, rat pricing
46656 Prednisolone VETRANAL, analytical standard human, mouse, rat pricing
P0130 Progesterone ≥99% human, mouse, rat pricing
P6149 Progesterone γ-irradiated, BioXtra, suitable for cell culture human, mouse, rat pricing
P8783 Progesterone powder, BioReagent, suitable for cell culture human, mouse, rat pricing
P3972 Progesterone meets USP testing specifications human, mouse, rat pricing
46665 Progesterone VETRANAL, analytical standard human, mouse, rat pricing
P7556 Progesterone-Water Soluble powder, BioReagent, suitable for cell culture human, mouse, rat pricing
T5411 Testosterone solution 1.0 mg/mL in 1,2-dimethoxyethane, drug standard human, mouse, rat pricing
H7904 (Z)-4-Hydroxytamoxifen ≥98% Z isomer human, rat pricing
H5752 17α-Hydroxyprogesterone ≥95% human, rat pricing
46337 17α-Hydroxyprogesterone VETRANAL, analytical standard human, rat pricing
N4128 19-Norethindrone ≥98%, powder human, rat pricing
46525 19-Norethindrone VETRANAL, analytical standard human, rat pricing
N7252 19-Nortestosterone human, rat pricing
74640 19-Nortestosterone ≥99.0% (HPLC) human, rat pricing
H4637 4-Hydroxyestradiol human, rat pricing
H6278 4-Hydroxytamoxifen ≥70% Z isomer (remainder primarily E-isomer) human, rat pricing
T176 4-Hydroxytamoxifen analytical standard, (E) and (Z) isomers (50:50) human, rat pricing
P9129 5-Pregnen-3β-ol-20-one ≥98% human, rat pricing
E8750 α-Estradiol powder, ≥98% (TLC) human, rat pricing
A9477 Aldosterone ≥95% (HPLC) human, rat pricing
31579 Androsterone VETRANAL, analytical standard human, rat pricing
C8667 Cholesterol Sigma Grade, ≥99% human, rat pricing
C8503 Cholesterol from sheep wool, ≥92.5% (GC), powder human, rat pricing
C3045 Cholesterol powder, BioReagent, suitable for cell culture, ≥99% human, rat pricing
C3292 Cholesterol ≥95% (GC), powder, Ash, free human, rat pricing
26732 Cholesterol from lanolin, ≥99.0% (GC) human, rat pricing
26740 Cholesterol from lanolin, ≥95.0% (GC) human, rat pricing
14606 Cholesterol tested according to Ph.Eur. human, rat pricing
47127-U Cholesterol solution certified reference material, 10 mg/mL in chloroform human, rat pricing
C1231 Cholesterol, Plant-Derived SyntheChol®, PharmaGrade, USP/NF, Ph Eur, Manufactured under appropriate GMP controls for pharma or biopharmaceutical production human, rat pricing
C2505 Corticosterone ≥92% human, rat pricing
46148 Corticosterone VETRANAL, analytical standard human, rat pricing
27840 Corticosterone ≥98.5% (HPLC) human, rat pricing
M1629 Medroxyprogesterone 17-acetate ≥97% (HPLC) human, rat pricing
46476 Nandrolone VETRANAL, analytical standard human, rat pricing
S3378 Spironolactone 97.0-103.0% human, rat pricing
S5442 SyntheChol® NS0 Supplement 500 ×, synthetic cholesterol, animal component-free, aqueous solution, sterile-filtered, suitable for cell culture human, rat pricing
T5648 Tamoxifen ≥99% human, rat pricing
T1875 Testosterone propionate solid human, rat pricing
86541 Testosterone propionate tested according to Ph.Eur. human, rat pricing
136123 trans-Chalcone 97% human, rat pricing
D4000 trans-Dehydroandrosterone ≥99% human, rat pricing
B39607 1,1-Dichloro-2,2-bis(4-chlorophenyl)ethane technical grade mouse, rat pricing
123897 1,1-Dichloro-2,2-bis(4-chlorophenyl)ethene 99% mouse, rat pricing
49018 2,4′-DDT analytical standard mouse, rat pricing
35486 4,4′-DDD PESTANAL®, analytical standard mouse, rat pricing
45837 4,4′-DDD solution PESTANAL®, analytical standard, 100 ng/μL in methanol mouse, rat pricing
40092 4,4′-DDD solution certified reference material, 5000 μg/mL in methanol mouse, rat pricing
35487 4,4′-DDE PESTANAL®, analytical standard mouse, rat pricing
48968 4,4′-DDE solution 200 μg/mL in isooctane, analytical standard mouse, rat pricing
40091 4,4′-DDE solution certified reference material, 5000 μg/mL in methanol mouse, rat pricing
48679 4,4′-DDE solution 20 μg/mL in methanol, analytical standard mouse, rat pricing
386340 4,4′-DDT 98% mouse, rat pricing
36662 4,4′-DDT solution 100 ng/μL in methanol, PESTANAL®, analytical standard mouse, rat pricing
48980 4,4′-DDT solution 200 μg/mL in isooctane, analytical standard mouse, rat pricing
40124 4,4′-DDT solution certified reference material, 5000 μg/mL in methanol mouse, rat pricing
46405 4-Nonylphenol PESTANAL®, analytical standard mouse, rat pricing
442873 4-Nonylphenol analytical standard mouse, rat pricing
425761 4-tert-Butylphenol purified by sublimation, 99% mouse, rat pricing
W391808 4-tert-Butylphenol ≥99%, FG mouse, rat pricing
B99901 4-tert-Butylphenol 99% mouse, rat pricing
506761 4-tert-Butylphenol analytical standard mouse, rat pricing
H4530 7-Hydroxyflavone ≥98% mouse, rat pricing
239658 Bisphenol A ≥99% mouse, rat pricing
133027 Bisphenol A 97% mouse, rat pricing
32015 Endosulfan PESTANAL®, analytical standard mouse, rat pricing
49049 γ-BHC analytical standard mouse, rat pricing
233390 Lindane 97% mouse, rat pricing
45548 Lindane PESTANAL®, analytical standard mouse, rat pricing
48982 Methoxychlor solution 200 μg/mL in isooctane, analytical standard mouse, rat pricing
290858 Nonylphenol technical grade, mixture of ring and chain isomers mouse, rat pricing
46018 Nonylphenol PESTANAL®, analytical standard, technical mixture mouse, rat pricing
181641 Poly(Bisphenol A carbonate) analytical standard mouse, rat pricing
181676 Poly(Bisphenol A carbonate) analytical standard, molecular weight series mouse, rat pricing
181625 Poly(Bisphenol A carbonate) average Mw ~45,000 by GPC mouse, rat pricing
435139 Poly(Bisphenol A carbonate) melt index 10-12 g/10 min (300°C/1.2kg) mouse, rat pricing
45405 (±)-Equol ≥99.0% (TLC) rat pricing
284858 (−)-Norgestrel 98% rat pricing
11970 1,3-Diphenyl-2-propenone ≥98.0% (GC) rat pricing
25925 1-(2-Chlorophenyl)-1-(4-chlorophenyl)-2,2-dichloroethane for diagnostic uses (cancer investigation), ≥98% (HPLC) rat pricing
M7252 17α-Methyltestosterone solid (photosensitive) rat pricing
46444 17α-Methyltestosterone VETRANAL, analytical standard rat pricing
69240 17α-Methyltestosterone ≥97.0% (HPLC) rat pricing
35485 2,4′-DDD PESTANAL®, analytical standard rat pricing
49015 2,4′-DDD analytical standard rat pricing
BCR289 2,4′-Dichlorobiphenyl BCR® certified Reference Material rat pricing
45667 2,4,5-T PESTANAL®, analytical standard rat pricing
46367 2,4,5-T solution 100 μg/mL in acetonitrile, PESTANAL®, analytical standard rat pricing
T5785 2,4,5-Trichlorophenoxyacetic acid plant cell culture tested, BioReagent, ≥95%, crystalline rat pricing
126217 2,4-Dihydroxybenzophenone 99% rat pricing
H3131 2-Hydroxyestradiol ≥95% (HPLC) rat pricing
B99006 2-sec-Butylphenol 98% rat pricing
36747 3-Chlorophenol PESTANAL®, analytical standard rat pricing
C62808 3-Chlorophenol 98% rat pricing
D110507 4,4′-Dihydroxybenzophenone 99% rat pricing
272930 4-(Benzyloxy)phenol ≥99% rat pricing
158348 4-(Benzyloxy)phenol 98% rat pricing
222070 4-(Heptyloxy)phenol 97% rat pricing
35833 4-Chloro-2-methylphenol PESTANAL®, analytical standard rat pricing
C55208 4-Chloro-2-methylphenol 97% rat pricing
C87800 4-Cumylphenol 99% rat pricing
372102 4-Dodecylphenol, mixture of isomers rat pricing
H20202 4-Hydroxybenzophenone 98% rat pricing
384445 4-Octylphenol 99% rat pricing
442850 4-Octylphenol analytical standard rat pricing
424625 4-Phenylphenol purified by sublimation, 99% rat pricing
134341 4-Phenylphenol 97% rat pricing
34068 4-Phenylphenol analytical standard rat pricing
135283 4-sec-Butylphenol 96% rat pricing
153842 4-tert-Amylphenol 99% rat pricing
A7755 5α-Androstane-3α,17β-diol rat pricing
419796 6-Hydroxyflavanone 99% rat pricing
411035 6-Hydroxyflavone 98% rat pricing
Z0166 α-Zearalenol rat pricing
36666 Aldrin PESTANAL®, analytical standard rat pricing
49000-U Aldrin analytical standard rat pricing
Z0417 β-Zearalanol ~98% (HPLC) rat pricing
Z2000 β-Zearalenol rat pricing
427551 Benzophenone purified by sublimation, ≥99% rat pricing
239852 Benzophenone ReagentPlus®, ≥99% rat pricing
B9300 Benzophenone ReagentPlus®, 99% rat pricing
W213403 Benzophenone ≥99%, FCC, FG rat pricing
442842 Benzophenone analytical standard rat pricing
45378 Chlordane (technical mixture) PESTANAL®, analytical standard rat pricing
45379 Chlordecone PESTANAL®, analytical standard rat pricing
N2260 D(−)-Norgestrel analytical standard rat pricing
I17206 Isoeugenol 98%, mixture of cis and trans rat pricing
W246808 Isoeugenol mixture of cis and trans, 99%, FG rat pricing
34038 Isoeugenol analytical standard rat pricing
M6013 Medroxyprogesterone rat pricing
46411 Medroxyprogesterone VETRANAL, analytical standard rat pricing
H6654 Methyl 4-hydroxybenzoate BioXtra, ≥99.0% (titration) rat pricing
H3647 Methyl 4-hydroxybenzoate BioReagent, suitable for insect cell culture rat pricing
M8911 Methyl 4-hydroxybenzoate analytical standard rat pricing
54752 Methyl 4-hydroxybenzoate tested according to Ph.Eur. rat pricing
W271004 Methyl 4-hydroxybenzoate ≥99%, FCC rat pricing
47889 Methyl Paraben analytical standard rat pricing
73664 Mettler-Toledo Calibration substance ME 18870, Benzophenone for the calibration of the thermosystem 900, traceable to primary standards (LGC) rat pricing
P5835 Propyl 4-hydroxybenzoate BioXtra rat pricing
54789 Propyl 4-hydroxybenzoate tested according to Ph.Eur. rat pricing
P53357 Propyl 4-hydroxybenzoate ≥99% rat pricing
T3925 Trenbolone analytical standard, for drug analysis rat pricing
V2375 Vanillin rat pricing
94752 Vanillin tested according to Ph.Eur. rat pricing
V1104 Vanillin ReagentPlus®, 99% rat pricing
W310727 Vanillin natural, ≥97%, FCC, FG rat pricing
Z0167 Zearalanone rat pricing

Small Molecule - Blocker

Product # Description Species Add to Cart
 
F9397 Flutamide human, mouse, rat pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
F7751 Fluoxymesterone solid (photosensitive) human pricing
R5010 Resveratrol ≥99% (HPLC) human, mouse, rat pricing
277738 Benzophenone-(carbonyl-13C) 99 atom % 13C human, rat pricing

Small Molecule - Ligand

Product # Description Species Add to Cart
 
86500 Testosterone purum, ≥99.0% (HPLC) human pricing
T1500 Testosterone ≥98% human, mouse, rat pricing
46923 Testosterone VETRANAL, analytical standard human, mouse, rat pricing

Small Molecule - Mixed Agonist/Antagonist

Product # Description Species Add to Cart
 
46412 Medroxyprogesterone 17-acetate VETRANAL, analytical standard human, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013476 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013476 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013476 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000044 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000044 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000044 MISSION® shRNA Lentiviral Transduction Particles human pricing

Related Products

Product # Description Species Add to Cart
 
MABS18 Anti-Aldose reductase Antibody, clone CPTC-AKR1B1-1 100 µg, Detect Aldose reductase using this Anti-Aldose reductase Antibody, clone CPTC-AKR1B1-1 validated for use in WB. pricing
AB3152 Anti-Amphiregulin Antibody 100 µg, This Anti-Amphiregulin Antibody is validated for use in ELISA, IP, WB for the detection of Amphiregulin. pricing
06-680 Anti-Androgen Receptor Antibody 100 µL, Anti-Androgen Receptor Antibody, PG-21 is a Rabbit Polyclonal Antibody for detection of Androgen Receptor also known as Dihydrotestosterone Receptor & has been tested in ICC, IHC, IP & WB. pricing
06-680-AF555 Anti-Androgen Receptor Antibody, Alexa Fluor® 555 Conjugate 100 µL, This Anti-Androgen Receptor Antibody, Alexa Fluor® 555 Conjugate is validated for use in Immunocytochemistry for the detection of Androgen Receptor. pricing
06-680-AF647 Anti-Androgen Receptor Antibody, Alexa Fluor® 647 Conjugate 100 µL, Detect Androgen Receptor using this Anti-Androgen Receptor Antibody, Alexa Fluor® 647 Conjugate validated for use in Immunocytochemistry. pricing
07-1375 Anti-phospho-Androgen Receptor (Ser81) Antibody 200 µL, Anti-phospho-Androgen Receptor (Ser81) Antibody is an antibody against phospho-Androgen Receptor (Ser81) for use in WB. pricing
04-078 Anti-phospho-Androgen Receptor (Ser81) Antibody, rabbit monoclonal 100 µL, Anti-phospho-Androgen Receptor (Ser81) Antibody detects level of phospho-Androgen Receptor (Ser81) & has been published & validated for use in WB. pricing
17-10489 ChIPAb+ Androgen Receptor- ChIP Validated Antibody and Primer Set 25 assays, ChIPAb+ &rogen Receptor set includes the &rogen Receptor antibody, a Normal Rabbit IgG, & control primers, which amplify a 85 bp region of the human prostate specific antigen (PSA) enhancer region. pricing
FCABS415PE Milli-Mark™ Anti-Androgen Receptor Antibody, PG-21-PE 100 tests, Milli-Mark Anti-Androgen Receptor Antibody, PG-21-PE detects level of Androgen Receptor & has been published & validated for use in FC. pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000044 Rosetta Predictions human pricing
NM_001011645 Rosetta Predictions human pricing
NM_012502 Rosetta Predictions rat pricing
NM_013476 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000044 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00224483 predicted 3126
2 SASI_Hs01_00224484 predicted 3521
3 SASI_Hs01_00224485 predicted 3491
4 SASI_Hs01_00224486 predicted 3105
5 SASI_Hs01_00224487 predicted 2948
6 SASI_Hs01_00224488 predicted 3797
7 SASI_Hs01_00224489 predicted 3368
8 SASI_Hs01_00224490 predicted 3315
9 SASI_Hs01_00224491 predicted 3786
10 SASI_Hs01_00224492 predicted 3106
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011645 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00104293 predicted 579
2 SASI_Hs01_00104294 predicted 970
3 SASI_Hs01_00104295 predicted 945
4 SASI_Hs01_00104296 predicted 556
5 SASI_Hs01_00104297 predicted 400
6 SASI_Hs01_00104298 predicted 1255
7 SASI_Hs01_00104299 predicted 818
8 SASI_Hs01_00104300 predicted 768
9 SASI_Hs01_00104301 predicted 1237
10 SASI_Hs01_00104302 predicted 561
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012502 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00057390 predicted 3579
2 SASI_Rn01_00057391 predicted 3338
3 SASI_Rn01_00057392 predicted 3588
4 SASI_Rn02_00259555 predicted 2731
5 SASI_Rn01_00057393 predicted 3318
6 SASI_Rn01_00057394 predicted 2912
7 SASI_Rn01_00057395 predicted 2296
8 SASI_Rn01_00057396 predicted 2524
9 SASI_Rn01_00057397 predicted 3530
10 SASI_Rn01_00057398 predicted 1919
11 SASI_Rn01_00057399 predicted 1904
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013476 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00027673 predicted 2678
2 SASI_Mm01_00027674 predicted 2609
3 SASI_Mm01_00027675 predicted 2367
4 SASI_Mm01_00027676 predicted 2613
5 SASI_Mm01_00027677 predicted 2347
6 SASI_Mm01_00027679 predicted 1960
7 SASI_Mm01_00027680 predicted 1943
8 SASI_Mm01_00027681 predicted 1045
9 SASI_Mm01_00027682 predicted 1329
10 SASI_Mm02_00322117 predicted 1554
11 SASI_Mm01_00027678 predicted 1762
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013476
AR MISSION shRNA Bacterial Glycerol Stock
androgen receptor
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000362532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013476.3-1331s21c1
Sequence:CCGGAGCTGAAGAAGGCCAATTATACTCGAGTATAATTGGCCTTCTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013476.3-1768s21c1
Sequence:CCGGACGATTGTACCATTGATAAATCTCGAGATTTATCAATGGTACAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013476.3-2193s21c1
Sequence:CCGGTGGATGGGACTGATGGTATTTCTCGAGAAATACCATCAGTCCCATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013476.2-2067s1c1
Sequence:CCGGGCCTTGTTATCTAGCCTCAATCTCGAGATTGAGGCTAGATAACAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013476.2-1039s1c1
Sequence:CCGGCCTCTCTGTCTCTGTATAAATCTCGAGATTTATACAGAGACAGAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026177    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013476.2-2776s1c1
Sequence:CCGGCCAGATGTCTTCTGCCTGTTACTCGAGTAACAGGCAGAAGACATCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013476.2-502s1c1
Sequence:CCGGCCGCCGACATTAAAGACATTTCTCGAGAAATGTCTTTAATGTCGGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013476.2-2609s1c1
Sequence:CCGGCCTGCTAATCAAGTCCCATATCTCGAGATATGGGACTTGATTAGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013476
AR MISSION shRNA shRNA Plasmid DNA
androgen receptor
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000362532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013476.3-1331s21c1
Sequence:CCGGAGCTGAAGAAGGCCAATTATACTCGAGTATAATTGGCCTTCTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013476.3-1768s21c1
Sequence:CCGGACGATTGTACCATTGATAAATCTCGAGATTTATCAATGGTACAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013476.3-2193s21c1
Sequence:CCGGTGGATGGGACTGATGGTATTTCTCGAGAAATACCATCAGTCCCATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013476.2-2067s1c1
Sequence:CCGGGCCTTGTTATCTAGCCTCAATCTCGAGATTGAGGCTAGATAACAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013476.2-1039s1c1
Sequence:CCGGCCTCTCTGTCTCTGTATAAATCTCGAGATTTATACAGAGACAGAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026177    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013476.2-2776s1c1
Sequence:CCGGCCAGATGTCTTCTGCCTGTTACTCGAGTAACAGGCAGAAGACATCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013476.2-502s1c1
Sequence:CCGGCCGCCGACATTAAAGACATTTCTCGAGAAATGTCTTTAATGTCGGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013476.2-2609s1c1
Sequence:CCGGCCTGCTAATCAAGTCCCATATCTCGAGATATGGGACTTGATTAGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013476
AR MISSION shRNA Lentiviral Transduction Particles
androgen receptor
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000362532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013476.3-1331s21c1
Sequence:CCGGAGCTGAAGAAGGCCAATTATACTCGAGTATAATTGGCCTTCTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013476.3-1768s21c1
Sequence:CCGGACGATTGTACCATTGATAAATCTCGAGATTTATCAATGGTACAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013476.3-2193s21c1
Sequence:CCGGTGGATGGGACTGATGGTATTTCTCGAGAAATACCATCAGTCCCATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013476.2-2067s1c1
Sequence:CCGGGCCTTGTTATCTAGCCTCAATCTCGAGATTGAGGCTAGATAACAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013476.2-1039s1c1
Sequence:CCGGCCTCTCTGTCTCTGTATAAATCTCGAGATTTATACAGAGACAGAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026177    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013476.2-2776s1c1
Sequence:CCGGCCAGATGTCTTCTGCCTGTTACTCGAGTAACAGGCAGAAGACATCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013476.2-502s1c1
Sequence:CCGGCCGCCGACATTAAAGACATTTCTCGAGAAATGTCTTTAATGTCGGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013476.2-2609s1c1
Sequence:CCGGCCTGCTAATCAAGTCCCATATCTCGAGATATGGGACTTGATTAGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000044
VALIDATED
AR MISSION shRNA Bacterial Glycerol Stock
androgen receptor
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_000044.2-3779s21c1
Sequence:CCGGGAGCGTGGACTTTCCGGAAATCTCGAGATTTCCGGAAAGTCCACGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_000044.2-3755s21c1
Sequence:CCGGCCTGCTAATCAAGTCACACATCTCGAGATGTGTGACTTGATTAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_000044.2-3380s21c1
Sequence:CCGGCACCAATGTCAACTCCAGGATCTCGAGATCCTGGAGTTGACATTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000044.2-2969s21c1
Sequence:CCGGGAAATGTTATGAAGCAGGGATCTCGAGATCCCTGCTTCATAACATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314730    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_000044.2-3925s21c1
Sequence:CCGGGATGTCTTCTGCCTGTTATAACTCGAGTTATAACAGGCAGAAGACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_000044.x-3755s1c1
Sequence:CCGGCCTGCTAATCAAGTCACACATCTCGAGATGTGTGACTTGATTAGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_000044.x-3380s1c1
Sequence:CCGGCACCAATGTCAACTCCAGGATCTCGAGATCCTGGAGTTGACATTGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_000044.x-2199s1c1
Sequence:CCGGCGCGACTACTACAACTTTCCACTCGAGTGGAAAGTTGTAGTAGTCGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000044
VALIDATED
AR MISSION shRNA shRNA Plasmid DNA
androgen receptor
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_000044.2-3779s21c1
Sequence:CCGGGAGCGTGGACTTTCCGGAAATCTCGAGATTTCCGGAAAGTCCACGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_000044.2-3755s21c1
Sequence:CCGGCCTGCTAATCAAGTCACACATCTCGAGATGTGTGACTTGATTAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_000044.2-3380s21c1
Sequence:CCGGCACCAATGTCAACTCCAGGATCTCGAGATCCTGGAGTTGACATTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000044.2-2969s21c1
Sequence:CCGGGAAATGTTATGAAGCAGGGATCTCGAGATCCCTGCTTCATAACATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314730    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_000044.2-3925s21c1
Sequence:CCGGGATGTCTTCTGCCTGTTATAACTCGAGTTATAACAGGCAGAAGACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_000044.x-3755s1c1
Sequence:CCGGCCTGCTAATCAAGTCACACATCTCGAGATGTGTGACTTGATTAGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_000044.x-3380s1c1
Sequence:CCGGCACCAATGTCAACTCCAGGATCTCGAGATCCTGGAGTTGACATTGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_000044.x-2199s1c1
Sequence:CCGGCGCGACTACTACAACTTTCCACTCGAGTGGAAAGTTGTAGTAGTCGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000044
VALIDATED
AR MISSION shRNA Lentiviral Transduction Particles
androgen receptor
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_000044.2-3779s21c1
Sequence:CCGGGAGCGTGGACTTTCCGGAAATCTCGAGATTTCCGGAAAGTCCACGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_000044.2-3755s21c1
Sequence:CCGGCCTGCTAATCAAGTCACACATCTCGAGATGTGTGACTTGATTAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_000044.2-3380s21c1
Sequence:CCGGCACCAATGTCAACTCCAGGATCTCGAGATCCTGGAGTTGACATTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000044.2-2969s21c1
Sequence:CCGGGAAATGTTATGAAGCAGGGATCTCGAGATCCCTGCTTCATAACATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314730    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_000044.2-3925s21c1
Sequence:CCGGGATGTCTTCTGCCTGTTATAACTCGAGTTATAACAGGCAGAAGACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_000044.x-3755s1c1
Sequence:CCGGCCTGCTAATCAAGTCACACATCTCGAGATGTGTGACTTGATTAGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_000044.x-3380s1c1
Sequence:CCGGCACCAATGTCAACTCCAGGATCTCGAGATCCTGGAGTTGACATTGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_000044.x-2199s1c1
Sequence:CCGGCGCGACTACTACAACTTTCCACTCGAGTGGAAAGTTGTAGTAGTCGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks