EMAIL THIS PAGE TO A FRIEND

ARAF

v-raf murine sarcoma 3611 viral oncogene homolog

109 Gene Product Result for
Synonyms: A-RAF ARAF1 PKS2 RAFA1
UniProtKB ID: P10398, P07557, Q5H9B2, Q5H9B3
Gene ID:
Human(369) Summary: This proto-oncogene belongs to the RAF subfamily of the Ser/Thr protein kinase family, and maybe involved in cell growth and development. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Jan 2012]
Mouse(11836) v-raf murine sarcoma 3611 viral oncogene homolog
Rat(64363) v-raf murine sarcoma 3611 viral oncogene homolog
Zebrafish(403063) v-raf murine sarcoma 3611 viral oncogene homolog
dog(491857) v-raf murine sarcoma 3611 viral oncogene homolog
cow(540421) v-raf murine sarcoma 3611 viral oncogene homolog
domestic guinea pig(100727629) v-raf murine sarcoma 3611 viral oncogene homolog
naked mole-rat(101723157) v-raf murine sarcoma 3611 viral oncogene homolog
sheep(100305131) v-raf murine sarcoma 3611 viral oncogene homolog
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1306389 ANTI-A-RAF (ARAF1) (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunohistochemistry, western blot pricing
SAB4501585 Anti-A-RAF antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunohistochemistry, western blot pricing
A5732 Anti-ARAF (40-54) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB1412006 ANTI-ARAF antibody produced in mouse clone 5H8, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412007 ANTI-ARAF antibody produced in mouse clone 4H7, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412008 ANTI-ARAF antibody produced in mouse clone 3G2, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
AV54592 Anti-ARAF antibody produced in rabbit affinity isolated antibody canine, sheep, rabbit, human, mouse, rat, horse, bovine, pig
western blot pricing
SAB1410721 Anti-ARAF antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
HPA066326 Anti-ARAF antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
HPA046188 Anti-ARAF antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence, western blot pricing
SAB1302616 ANTI-MOUSE ARAF (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB4504078 Anti-phospho-A-RAF (pTyr302) antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
WH0000369M1 Monoclonal Anti-ARAF antibody produced in mouse clone 6H6, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1403564 Monoclonal Anti-ARAF antibody produced in mouse clone 3E2, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009703 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009703 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009703 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001654 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001654 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001654 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001654 siRNAs that have been validated in the lab human pricing
NM_001033663 Rosetta Predictions rat pricing
NM_022532 Rosetta Predictions rat pricing
NM_009703 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001654 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00128118 validated 576
1 SASI_Hs01_00128119 validated 516
1 SASI_Hs01_00128117 validated 313
2 SASI_Hs01_00128120 predicted 1217
3 SASI_Hs02_00332253 predicted 563
4 SASI_Hs01_00128121 predicted 1222
5 SASI_Hs01_00128122 predicted 851
6 SASI_Hs01_00128123 predicted 1423
7 SASI_Hs01_00128124 predicted 245
8 SASI_Hs01_00128126 predicted 1083
9 SASI_Hs01_00128125 predicted 1288
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033663 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00203658 predicted 214
2 SASI_Rn02_00203659 predicted 205
3 SASI_Rn02_00203660 predicted 291
4 SASI_Rn01_00061958 predicted 407
5 SASI_Rn01_00061959 predicted 274
6 SASI_Rn01_00061960 predicted 288
7 SASI_Rn02_00203661 predicted 217
8 SASI_Rn01_00061961 predicted 430
9 SASI_Rn01_00061962 predicted 383
10 SASI_Rn02_00203662 predicted 330
11 SASI_Rn01_00061956 predicted 344
12 SASI_Rn01_00061957 predicted 373
13 SASI_Rn01_00061963 predicted 364
14 SASI_Rn01_00061964 predicted 381
15 SASI_Rn01_00061965 predicted 270
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022532 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00263280 predicted 213
2 SASI_Rn02_00263281 predicted 207
3 SASI_Rn02_00263282 predicted 297
4 SASI_Rn01_00097849 predicted 406
5 SASI_Rn01_00097850 predicted 274
6 SASI_Rn01_00097851 predicted 289
7 SASI_Rn02_00263283 predicted 219
8 SASI_Rn01_00097852 predicted 432
9 SASI_Rn01_00097853 predicted 383
10 SASI_Rn02_00263284 predicted 336
11 SASI_Rn01_00097847 predicted 396
12 SASI_Rn01_00097848 predicted 421
13 SASI_Rn01_00097854 predicted 414
14 SASI_Rn01_00097855 predicted 427
15 SASI_Rn01_00097856 predicted 315
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009703 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00022296 predicted 205
2 SASI_Mm01_00022297 predicted 427
3 SASI_Mm01_00022298 predicted 470
4 SASI_Mm01_00022299 predicted 420
5 SASI_Mm01_00022300 predicted 1353
6 SASI_Mm01_00022301 predicted 728
7 SASI_Mm01_00022303 predicted 530
8 SASI_Mm01_00022304 predicted 729
9 SASI_Mm01_00022305 predicted 432
10 SASI_Mm02_00316834 predicted 1281
11 SASI_Mm01_00022302 predicted 1995
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009703
VALIDATED
ARAF MISSION shRNA Bacterial Glycerol Stock
v-raf murine sarcoma 3611 viral oncogene homolog
Mouse
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000022609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009703.1-1348s1c1
Sequence:CCGGCACGCCAAGAACATCATTCATCTCGAGATGAATGATGTTCTTGGCGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009703.1-206s1c1
Sequence:CCGGGCATGAGTGTCTATGACTCTTCTCGAGAAGAGTCATAGACACTCATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009703.1-1552s1c1
Sequence:CCGGCAGTCGGATGTCTATGCCTATCTCGAGATAGGCATAGACATCCGACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009703.1-279s1c1
Sequence:CCGGCAGGCTCATCAAAGGAAGAAACTCGAGTTTCTTCCTTTGATGAGCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009703.1-789s1c1
Sequence:CCGGGCAGTTTACTGCTCAGAGCTTCTCGAGAAGCTCTGAGCAGTAAACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009703.1-522s1c1
Sequence:CCGGCTGCGTTGACATGAGTACCAACTCGAGTTGGTACTCATGTCAACGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009703.1-1567s1c1
Sequence:CCGGGCCTATGGTGTTGTGCTCTATCTCGAGATAGAGCACAACACCATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009703.1-1374s1c1
Sequence:CCGGCCTAAAGTCCAACAATATCTTCTCGAGAAGATATTGTTGGACTTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009703.1-1075s1c1
Sequence:CCGGCATGGCGATGTAGCTGTGAAACTCGAGTTTCACAGCTACATCGCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009703.1-152s1c1
Sequence:CCGGCTGTCAAAGTGTACCTGCCTACTCGAGTAGGCAGGTACACTTTGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009703.2-566s21c1
Sequence:CCGGCTGCGTTGACATGAGTACCAACTCGAGTTGGTACTCATGTCAACGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294820    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009703.2-2107s21c1
Sequence:CCGGTCTCCTGCTTTCTCCATAATTCTCGAGAATTATGGAGAAAGCAGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009703.2-1210s21c1
Sequence:CCGGAGACACGGCATGTCAACATTTCTCGAGAAATGTTGACATGCCGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009703.2-250s21c1
Sequence:CCGGGCATGAGTGTCTATGACTCTTCTCGAGAAGAGTCATAGACACTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009703.2-323s21c1
Sequence:CCGGCAGGCTCATCAAAGGAAGAAACTCGAGTTTCTTCCTTTGATGAGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009703
VALIDATED
ARAF MISSION shRNA shRNA Plasmid DNA
v-raf murine sarcoma 3611 viral oncogene homolog
Mouse
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000022609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009703.1-1348s1c1
Sequence:CCGGCACGCCAAGAACATCATTCATCTCGAGATGAATGATGTTCTTGGCGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009703.1-206s1c1
Sequence:CCGGGCATGAGTGTCTATGACTCTTCTCGAGAAGAGTCATAGACACTCATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009703.1-1552s1c1
Sequence:CCGGCAGTCGGATGTCTATGCCTATCTCGAGATAGGCATAGACATCCGACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009703.1-279s1c1
Sequence:CCGGCAGGCTCATCAAAGGAAGAAACTCGAGTTTCTTCCTTTGATGAGCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009703.1-789s1c1
Sequence:CCGGGCAGTTTACTGCTCAGAGCTTCTCGAGAAGCTCTGAGCAGTAAACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009703.1-522s1c1
Sequence:CCGGCTGCGTTGACATGAGTACCAACTCGAGTTGGTACTCATGTCAACGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009703.1-1567s1c1
Sequence:CCGGGCCTATGGTGTTGTGCTCTATCTCGAGATAGAGCACAACACCATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009703.1-1374s1c1
Sequence:CCGGCCTAAAGTCCAACAATATCTTCTCGAGAAGATATTGTTGGACTTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009703.1-1075s1c1
Sequence:CCGGCATGGCGATGTAGCTGTGAAACTCGAGTTTCACAGCTACATCGCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009703.1-152s1c1
Sequence:CCGGCTGTCAAAGTGTACCTGCCTACTCGAGTAGGCAGGTACACTTTGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009703.2-566s21c1
Sequence:CCGGCTGCGTTGACATGAGTACCAACTCGAGTTGGTACTCATGTCAACGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294820    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009703.2-2107s21c1
Sequence:CCGGTCTCCTGCTTTCTCCATAATTCTCGAGAATTATGGAGAAAGCAGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009703.2-1210s21c1
Sequence:CCGGAGACACGGCATGTCAACATTTCTCGAGAAATGTTGACATGCCGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009703.2-250s21c1
Sequence:CCGGGCATGAGTGTCTATGACTCTTCTCGAGAAGAGTCATAGACACTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009703.2-323s21c1
Sequence:CCGGCAGGCTCATCAAAGGAAGAAACTCGAGTTTCTTCCTTTGATGAGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009703
VALIDATED
ARAF MISSION shRNA Lentiviral Transduction Particles
v-raf murine sarcoma 3611 viral oncogene homolog
Mouse
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000022609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009703.1-1348s1c1
Sequence:CCGGCACGCCAAGAACATCATTCATCTCGAGATGAATGATGTTCTTGGCGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009703.1-206s1c1
Sequence:CCGGGCATGAGTGTCTATGACTCTTCTCGAGAAGAGTCATAGACACTCATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009703.1-1552s1c1
Sequence:CCGGCAGTCGGATGTCTATGCCTATCTCGAGATAGGCATAGACATCCGACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009703.1-279s1c1
Sequence:CCGGCAGGCTCATCAAAGGAAGAAACTCGAGTTTCTTCCTTTGATGAGCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009703.1-789s1c1
Sequence:CCGGGCAGTTTACTGCTCAGAGCTTCTCGAGAAGCTCTGAGCAGTAAACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009703.1-522s1c1
Sequence:CCGGCTGCGTTGACATGAGTACCAACTCGAGTTGGTACTCATGTCAACGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009703.1-1567s1c1
Sequence:CCGGGCCTATGGTGTTGTGCTCTATCTCGAGATAGAGCACAACACCATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009703.1-1374s1c1
Sequence:CCGGCCTAAAGTCCAACAATATCTTCTCGAGAAGATATTGTTGGACTTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009703.1-1075s1c1
Sequence:CCGGCATGGCGATGTAGCTGTGAAACTCGAGTTTCACAGCTACATCGCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009703.1-152s1c1
Sequence:CCGGCTGTCAAAGTGTACCTGCCTACTCGAGTAGGCAGGTACACTTTGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009703.2-566s21c1
Sequence:CCGGCTGCGTTGACATGAGTACCAACTCGAGTTGGTACTCATGTCAACGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294820    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009703.2-2107s21c1
Sequence:CCGGTCTCCTGCTTTCTCCATAATTCTCGAGAATTATGGAGAAAGCAGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009703.2-1210s21c1
Sequence:CCGGAGACACGGCATGTCAACATTTCTCGAGAAATGTTGACATGCCGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009703.2-250s21c1
Sequence:CCGGGCATGAGTGTCTATGACTCTTCTCGAGAAGAGTCATAGACACTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009703.2-323s21c1
Sequence:CCGGCAGGCTCATCAAAGGAAGAAACTCGAGTTTCTTCCTTTGATGAGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001654
VALIDATED
ARAF MISSION shRNA Bacterial Glycerol Stock
v-raf murine sarcoma 3611 viral oncogene homolog
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000000567    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_001654.x-2083s1c1
Sequence:CCGGCCAGCCAATCAATGTTCGTCTCTCGAGAGACGAACATTGATTGGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_001654.x-1495s1c1
Sequence:CCGGGTCTAACAACATCTTCCTACACTCGAGTGTAGGAAGATGTTGTTAGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000571    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_001654.x-390s1c1
Sequence:CCGGGACTCATCAAGGGACGAAAGACTCGAGTCTTTCGTCCCTTGATGAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001654.x-1299s1c1
Sequence:CCGGTCTTGCTGTTTATGGGCTTCACTCGAGTGAAGCCCATAAACAGCAAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_001654.1-921s1c1
Sequence:CCGGGCACTGATGCTGCCGGTAGTACTCGAGTACTACCGGCAGCATCAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_001654.1-1622s1c1
Sequence:CCGGGCAGCTGAGGTGATCCGTATGCTCGAGCATACGGATCACCTCAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199992    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001654.1-2224s1c1
Sequence:CCGGCCTCCATCATTTGGTTTCCTCCTCGAGGAGGAAACCAAATGATGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199244    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_001654.1-2216s1c1
Sequence:CCGGCCCTGTCTCCTCCATCATTTGCTCGAGCAAATGATGGAGGAGACAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A-431
TRC Version: 1 Clone ID:NM_001654.1-655s1c1
Sequence:CCGGCCAACAGTTCTACCACAGTGTCTCGAGACACTGTGGTAGAACTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_001654.2-1621s21c1
Sequence:GTACCGGGGTTGTGCTCTACGAGCTTATCTCGAGATAAGCTCGTAGAGCACAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_001654.2-1674s21c1
Sequence:CCGGGCCGTGACCAGATTATCTTTACTCGAGTAAAGATAATCTGGTCACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_001654.2-1553s21c1
Sequence:CCGGGCAGCTGAGGTGATCCGTATGCTCGAGCATACGGATCACCTCAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_001654.2-321s21c1
Sequence:CCGGGACTCATCAAGGGACGAAAGACTCGAGTCTTTCGTCCCTTGATGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315099    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001654.2-2014s21c1
Sequence:CCGGCCAGCCAATCAATGTTCGTCTCTCGAGAGACGAACATTGATTGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315030    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_001654.2-772s21c1
Sequence:CCGGGTCCACTCCCAACGTCCATATCTCGAGATATGGACGTTGGGAGTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001654
VALIDATED
ARAF MISSION shRNA shRNA Plasmid DNA
v-raf murine sarcoma 3611 viral oncogene homolog
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000000567    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_001654.x-2083s1c1
Sequence:CCGGCCAGCCAATCAATGTTCGTCTCTCGAGAGACGAACATTGATTGGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_001654.x-1495s1c1
Sequence:CCGGGTCTAACAACATCTTCCTACACTCGAGTGTAGGAAGATGTTGTTAGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000571    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_001654.x-390s1c1
Sequence:CCGGGACTCATCAAGGGACGAAAGACTCGAGTCTTTCGTCCCTTGATGAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001654.x-1299s1c1
Sequence:CCGGTCTTGCTGTTTATGGGCTTCACTCGAGTGAAGCCCATAAACAGCAAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_001654.1-921s1c1
Sequence:CCGGGCACTGATGCTGCCGGTAGTACTCGAGTACTACCGGCAGCATCAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_001654.1-1622s1c1
Sequence:CCGGGCAGCTGAGGTGATCCGTATGCTCGAGCATACGGATCACCTCAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199992    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001654.1-2224s1c1
Sequence:CCGGCCTCCATCATTTGGTTTCCTCCTCGAGGAGGAAACCAAATGATGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199244    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_001654.1-2216s1c1
Sequence:CCGGCCCTGTCTCCTCCATCATTTGCTCGAGCAAATGATGGAGGAGACAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A-431
TRC Version: 1 Clone ID:NM_001654.1-655s1c1
Sequence:CCGGCCAACAGTTCTACCACAGTGTCTCGAGACACTGTGGTAGAACTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_001654.2-1621s21c1
Sequence:GTACCGGGGTTGTGCTCTACGAGCTTATCTCGAGATAAGCTCGTAGAGCACAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_001654.2-1674s21c1
Sequence:CCGGGCCGTGACCAGATTATCTTTACTCGAGTAAAGATAATCTGGTCACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_001654.2-1553s21c1
Sequence:CCGGGCAGCTGAGGTGATCCGTATGCTCGAGCATACGGATCACCTCAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_001654.2-321s21c1
Sequence:CCGGGACTCATCAAGGGACGAAAGACTCGAGTCTTTCGTCCCTTGATGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315099    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001654.2-2014s21c1
Sequence:CCGGCCAGCCAATCAATGTTCGTCTCTCGAGAGACGAACATTGATTGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315030    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_001654.2-772s21c1
Sequence:CCGGGTCCACTCCCAACGTCCATATCTCGAGATATGGACGTTGGGAGTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001654
VALIDATED
ARAF MISSION shRNA Lentiviral Transduction Particles
v-raf murine sarcoma 3611 viral oncogene homolog
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000000567    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_001654.x-2083s1c1
Sequence:CCGGCCAGCCAATCAATGTTCGTCTCTCGAGAGACGAACATTGATTGGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_001654.x-1495s1c1
Sequence:CCGGGTCTAACAACATCTTCCTACACTCGAGTGTAGGAAGATGTTGTTAGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000571    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_001654.x-390s1c1
Sequence:CCGGGACTCATCAAGGGACGAAAGACTCGAGTCTTTCGTCCCTTGATGAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001654.x-1299s1c1
Sequence:CCGGTCTTGCTGTTTATGGGCTTCACTCGAGTGAAGCCCATAAACAGCAAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_001654.1-921s1c1
Sequence:CCGGGCACTGATGCTGCCGGTAGTACTCGAGTACTACCGGCAGCATCAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_001654.1-1622s1c1
Sequence:CCGGGCAGCTGAGGTGATCCGTATGCTCGAGCATACGGATCACCTCAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199992    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001654.1-2224s1c1
Sequence:CCGGCCTCCATCATTTGGTTTCCTCCTCGAGGAGGAAACCAAATGATGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199244    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_001654.1-2216s1c1
Sequence:CCGGCCCTGTCTCCTCCATCATTTGCTCGAGCAAATGATGGAGGAGACAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A-431
TRC Version: 1 Clone ID:NM_001654.1-655s1c1
Sequence:CCGGCCAACAGTTCTACCACAGTGTCTCGAGACACTGTGGTAGAACTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_001654.2-1621s21c1
Sequence:GTACCGGGGTTGTGCTCTACGAGCTTATCTCGAGATAAGCTCGTAGAGCACAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_001654.2-1674s21c1
Sequence:CCGGGCCGTGACCAGATTATCTTTACTCGAGTAAAGATAATCTGGTCACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_001654.2-1553s21c1
Sequence:CCGGGCAGCTGAGGTGATCCGTATGCTCGAGCATACGGATCACCTCAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_001654.2-321s21c1
Sequence:CCGGGACTCATCAAGGGACGAAAGACTCGAGTCTTTCGTCCCTTGATGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315099    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001654.2-2014s21c1
Sequence:CCGGCCAGCCAATCAATGTTCGTCTCTCGAGAGACGAACATTGATTGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315030    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_001654.2-772s21c1
Sequence:CCGGGTCCACTCCCAACGTCCATATCTCGAGATATGGACGTTGGGAGTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks