EMAIL THIS PAGE TO A FRIEND

ARAP1

ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 1

161 Gene Product Result for
Synonyms: CENTD2
Gene ID:
Human(116985) Summary: The protein encoded by this gene contains SAM, ARF-GAP, RHO-GAP, ankyrin repeat, RAS-associating, and pleckstrin homology (PH) domains. In vitro, this protein displays RHO-GAP and phosphatidylinositol (3,4,5) trisphosphate (PIP3)-dependent ARF-GAP activity. The encoded protein associates with the Golgi, and the ARF-GAP activity mediates changes in the Golgi and the formation of filopodia. It is thought to regulate the cell-specific trafficking of a receptor protein involved in apoptosis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2008]
Mouse(69710) ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 1
Rat(361617) ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 1
dog(485207) ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 1
Horse(100052506) ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 1
cow(511889) ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 1
domestic cat(101095128) ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 1
sheep(101123146) ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 1
naked mole-rat(101724042) ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 1
domestic guinea pig(100731432) ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015242 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015242 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015242 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001040111 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001040111 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001040111 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU065221 MISSION® esiRNA esiRNA human ARAP1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001040118 Rosetta Predictions human pricing
NM_015242 Rosetta Predictions human pricing
NM_139181 Rosetta Predictions human pricing
XM_001059932 Rosetta Predictions rat pricing
XM_001066901 Rosetta Predictions rat pricing
XM_001066946 Rosetta Predictions rat pricing
XM_341895 Rosetta Predictions rat pricing
NM_001040111 Rosetta Predictions mouse pricing
NM_001040112 Rosetta Predictions mouse pricing
NM_027180 Rosetta Predictions mouse pricing
NM_198096 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040118 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00044535 predicted 1921
2 SASI_Hs01_00044536 predicted 3645
3 SASI_Hs01_00044537 predicted 2898
4 SASI_Hs01_00044538 predicted 3394
5 SASI_Hs01_00044539 predicted 4158
6 SASI_Hs01_00044540 predicted 1689
7 SASI_Hs01_00044541 predicted 2513
8 SASI_Hs01_00044542 predicted 2448
9 SASI_Hs02_00308838 predicted 1791
10 SASI_Hs02_00308839 predicted 3225
11 SASI_Hs01_00044543 predicted 1098
12 SASI_Hs01_00044544 predicted 4135
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015242 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00139443 predicted 1759
2 SASI_Hs01_00139444 predicted 3483
3 SASI_Hs01_00139445 predicted 2738
4 SASI_Hs01_00139446 predicted 3235
5 SASI_Hs01_00139447 predicted 3994
6 SASI_Hs01_00139448 predicted 1534
7 SASI_Hs01_00139449 predicted 2341
8 SASI_Hs01_00139450 predicted 2284
9 SASI_Hs02_00347376 predicted 1621
10 SASI_Hs02_00347377 predicted 3053
11 SASI_Hs01_00139451 predicted 929
12 SASI_Hs01_00139452 predicted 3979
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139181 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00016786 predicted 1895
2 SASI_Hs01_00016787 predicted 3626
3 SASI_Hs01_00016788 predicted 2874
4 SASI_Hs01_00016789 predicted 3374
5 SASI_Hs01_00016790 predicted 4134
6 SASI_Hs01_00016791 predicted 1666
7 SASI_Hs01_00016792 predicted 2484
8 SASI_Hs01_00016793 predicted 2420
9 SASI_Hs02_00364219 predicted 1764
10 SASI_Hs02_00364220 predicted 3201
11 SASI_Hs01_00016794 predicted 1072
12 SASI_Hs01_00016795 predicted 4120
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001059932 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00294852 predicted 796
2 SASI_Rn02_00294853 predicted 4024
3 SASI_Rn02_00294854 predicted 2520
4 SASI_Rn02_00294855 predicted 1097
5 SASI_Rn02_00294856 predicted 2975
6 SASI_Rn02_00294857 predicted 1188
7 SASI_Rn02_00294858 predicted 3878
8 SASI_Rn02_00294859 predicted 2062
9 SASI_Rn02_00294860 predicted 3172
10 SASI_Rn02_00294861 predicted 3988
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001066901 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00319142 predicted 1393
2 SASI_Rn02_00319143 predicted 4654
3 SASI_Rn02_00319144 predicted 777
4 SASI_Rn02_00319145 predicted 3112
5 SASI_Rn02_00319146 predicted 1688
6 SASI_Rn02_00319147 predicted 3577
7 SASI_Rn02_00319148 predicted 1788
8 SASI_Rn02_00319149 predicted 4513
9 SASI_Rn02_00319150 predicted 2659
10 SASI_Rn02_00319151 predicted 4612
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001066946 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00319322 predicted 796
2 SASI_Rn02_00319323 predicted 4021
3 SASI_Rn02_00319324 predicted 2517
4 SASI_Rn02_00319325 predicted 1097
5 SASI_Rn02_00319326 predicted 2981
6 SASI_Rn02_00319327 predicted 1187
7 SASI_Rn02_00319328 predicted 3885
8 SASI_Rn02_00319329 predicted 2054
9 SASI_Rn02_00319330 predicted 3174
10 SASI_Rn02_00319331 predicted 3984
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_341895 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00393543 predicted 1391
2 SASI_Rn02_00393544 predicted 4649
3 SASI_Rn02_00393545 predicted 769
4 SASI_Rn02_00393546 predicted 3118
5 SASI_Rn02_00393547 predicted 1692
6 SASI_Rn02_00393548 predicted 3575
7 SASI_Rn02_00393549 predicted 1788
8 SASI_Rn02_00393550 predicted 4515
9 SASI_Rn02_00393551 predicted 2650
10 SASI_Rn02_00393552 predicted 4610
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040111 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00106669 predicted 4244
2 SASI_Mm01_00106670 predicted 3500
3 SASI_Mm01_00106671 predicted 2629
4 SASI_Mm01_00106672 predicted 4224
5 SASI_Mm01_00106673 predicted 3553
6 SASI_Mm01_00106674 predicted 2651
7 SASI_Mm01_00106675 predicted 3472
8 SASI_Mm01_00106676 predicted 3878
9 SASI_Mm01_00106677 predicted 3908
10 SASI_Mm02_00290276 predicted 3861
11 SASI_Mm01_00106668 predicted 3710
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040112 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00043806 predicted 3716
2 SASI_Mm01_00043807 predicted 2974
3 SASI_Mm01_00043808 predicted 2108
4 SASI_Mm01_00043809 predicted 3705
5 SASI_Mm01_00043810 predicted 3033
6 SASI_Mm01_00043811 predicted 2127
7 SASI_Mm01_00043812 predicted 2946
8 SASI_Mm01_00043813 predicted 3357
9 SASI_Mm01_00043814 predicted 3386
10 SASI_Mm02_00290277 predicted 3336
11 SASI_Mm01_00043805 predicted 3182
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027180 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00331690 predicted 3330
2 SASI_Mm02_00331691 predicted 2586
3 SASI_Mm02_00331692 predicted 1722
4 SASI_Mm02_00331693 predicted 3317
5 SASI_Mm02_00331694 predicted 2646
6 SASI_Mm01_00061841 predicted 1738
7 SASI_Mm01_00061844 predicted 2568
8 SASI_Mm02_00331695 predicted 2972
9 SASI_Mm02_00331696 predicted 3004
10 SASI_Mm02_00331697 predicted 2951
11 SASI_Mm01_00061835 predicted 491
12 SASI_Mm01_00061836 predicted 500
13 SASI_Mm01_00061837 predicted 3570
14 SASI_Mm01_00061838 predicted 877
15 SASI_Mm01_00061839 predicted 1045
16 SASI_Mm01_00061840 predicted 1497
17 SASI_Mm01_00061842 predicted 708
18 SASI_Mm01_00061843 predicted 1112
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198096 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00185916 predicted 2080
2 SASI_Mm01_00185917 predicted 1329
3 SASI_Mm01_00185918 predicted 462
4 SASI_Mm01_00185919 predicted 2062
5 SASI_Mm01_00185920 predicted 1390
6 SASI_Mm01_00185921 predicted 483
7 SASI_Mm01_00185922 predicted 1314
8 SASI_Mm01_00185923 predicted 1709
9 SASI_Mm01_00185924 predicted 1745
10 SASI_Mm02_00350821 predicted 1698
11 SASI_Mm01_00185915 predicted 1539
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015242
VALIDATED
ARAP1 MISSION shRNA Bacterial Glycerol Stock
ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015242.4-2471s21c1
Sequence:CCGGGAGAACGGCTGTACCTGTTTGCTCGAGCAAACAGGTACAGCCGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015242.4-2515s21c1
Sequence:CCGGCATGAGTGGGTCAAGTGTATTCTCGAGAATACACTTGACCCACTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015242.4-3518s21c1
Sequence:CCGGACTTCATCTGCACAGTGTATCCTCGAGGATACACTGTGCAGATGAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015242.4-1799s21c1
Sequence:CCGGCACTTATCGAGCTCTTCTTACCTCGAGGTAAGAAGAGCTCGATAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438169    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015242.4-4630s21c1
Sequence:CCGGGCTGGAGAGATGGGCATAAGTCTCGAGACTTATGCCCATCTCTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015242.2-2271s1c1
Sequence:CCGGCATGGCTTTGAGCACACCTTTCTCGAGAAAGGTGTGCTCAAAGCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015242.2-3845s1c1
Sequence:CCGGGTGGCCTATTAAGAGTCTCAACTCGAGTTGAGACTCTTAATAGGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015242.2-3737s1c1
Sequence:CCGGCGATCGCTACTTCATCCTCAACTCGAGTTGAGGATGAAGTAGCGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015242.2-905s1c1
Sequence:CCGGCCTGCGATACTTTGACAGTAACTCGAGTTACTGTCAAAGTATCGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015242.2-852s1c1
Sequence:CCGGCCGCAGGGATCTTACATCTATCTCGAGATAGATGTAAGATCCCTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015242
VALIDATED
ARAP1 MISSION shRNA shRNA Plasmid DNA
ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015242.4-2471s21c1
Sequence:CCGGGAGAACGGCTGTACCTGTTTGCTCGAGCAAACAGGTACAGCCGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015242.4-2515s21c1
Sequence:CCGGCATGAGTGGGTCAAGTGTATTCTCGAGAATACACTTGACCCACTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015242.4-3518s21c1
Sequence:CCGGACTTCATCTGCACAGTGTATCCTCGAGGATACACTGTGCAGATGAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015242.4-1799s21c1
Sequence:CCGGCACTTATCGAGCTCTTCTTACCTCGAGGTAAGAAGAGCTCGATAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438169    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015242.4-4630s21c1
Sequence:CCGGGCTGGAGAGATGGGCATAAGTCTCGAGACTTATGCCCATCTCTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015242.2-2271s1c1
Sequence:CCGGCATGGCTTTGAGCACACCTTTCTCGAGAAAGGTGTGCTCAAAGCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015242.2-3845s1c1
Sequence:CCGGGTGGCCTATTAAGAGTCTCAACTCGAGTTGAGACTCTTAATAGGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015242.2-3737s1c1
Sequence:CCGGCGATCGCTACTTCATCCTCAACTCGAGTTGAGGATGAAGTAGCGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015242.2-905s1c1
Sequence:CCGGCCTGCGATACTTTGACAGTAACTCGAGTTACTGTCAAAGTATCGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015242.2-852s1c1
Sequence:CCGGCCGCAGGGATCTTACATCTATCTCGAGATAGATGTAAGATCCCTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015242
VALIDATED
ARAP1 MISSION shRNA Lentiviral Transduction Particles
ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015242.4-2471s21c1
Sequence:CCGGGAGAACGGCTGTACCTGTTTGCTCGAGCAAACAGGTACAGCCGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015242.4-2515s21c1
Sequence:CCGGCATGAGTGGGTCAAGTGTATTCTCGAGAATACACTTGACCCACTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015242.4-3518s21c1
Sequence:CCGGACTTCATCTGCACAGTGTATCCTCGAGGATACACTGTGCAGATGAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015242.4-1799s21c1
Sequence:CCGGCACTTATCGAGCTCTTCTTACCTCGAGGTAAGAAGAGCTCGATAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438169    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015242.4-4630s21c1
Sequence:CCGGGCTGGAGAGATGGGCATAAGTCTCGAGACTTATGCCCATCTCTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015242.2-2271s1c1
Sequence:CCGGCATGGCTTTGAGCACACCTTTCTCGAGAAAGGTGTGCTCAAAGCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015242.2-3845s1c1
Sequence:CCGGGTGGCCTATTAAGAGTCTCAACTCGAGTTGAGACTCTTAATAGGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015242.2-3737s1c1
Sequence:CCGGCGATCGCTACTTCATCCTCAACTCGAGTTGAGGATGAAGTAGCGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015242.2-905s1c1
Sequence:CCGGCCTGCGATACTTTGACAGTAACTCGAGTTACTGTCAAAGTATCGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015242.2-852s1c1
Sequence:CCGGCCGCAGGGATCTTACATCTATCTCGAGATAGATGTAAGATCCCTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001040111
VALIDATED
ARAP1 MISSION shRNA Bacterial Glycerol Stock
ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000247789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001040111.1-1299s21c1
Sequence:CCGGGGTGAGACTGGACGCTGATTACTCGAGTAATCAGCGTCCAGTCTCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247788    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001040111.1-5265s21c1
Sequence:CCGGGCATGTTTACTGAGCTATTTACTCGAGTAAATAGCTCAGTAAACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001040111.1-3329s21c1
Sequence:CCGGACGTCTCCTCTGCACTCAAACCTCGAGGTTTGAGTGCAGAGGAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001040111.1-2389s21c1
Sequence:CCGGATGGAGTTTCTACGGAATAATCTCGAGATTATTCCGTAGAAACTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001040111.1-1679s21c1
Sequence:CCGGTGGGCATTGGTATCACCTTTACTCGAGTAAAGGTGATACCAATGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001040111
VALIDATED
ARAP1 MISSION shRNA shRNA Plasmid DNA
ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000247789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001040111.1-1299s21c1
Sequence:CCGGGGTGAGACTGGACGCTGATTACTCGAGTAATCAGCGTCCAGTCTCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247788    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001040111.1-5265s21c1
Sequence:CCGGGCATGTTTACTGAGCTATTTACTCGAGTAAATAGCTCAGTAAACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001040111.1-3329s21c1
Sequence:CCGGACGTCTCCTCTGCACTCAAACCTCGAGGTTTGAGTGCAGAGGAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001040111.1-2389s21c1
Sequence:CCGGATGGAGTTTCTACGGAATAATCTCGAGATTATTCCGTAGAAACTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001040111.1-1679s21c1
Sequence:CCGGTGGGCATTGGTATCACCTTTACTCGAGTAAAGGTGATACCAATGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001040111
VALIDATED
ARAP1 MISSION shRNA Lentiviral Transduction Particles
ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000247789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001040111.1-1299s21c1
Sequence:CCGGGGTGAGACTGGACGCTGATTACTCGAGTAATCAGCGTCCAGTCTCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247788    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001040111.1-5265s21c1
Sequence:CCGGGCATGTTTACTGAGCTATTTACTCGAGTAAATAGCTCAGTAAACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001040111.1-3329s21c1
Sequence:CCGGACGTCTCCTCTGCACTCAAACCTCGAGGTTTGAGTGCAGAGGAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001040111.1-2389s21c1
Sequence:CCGGATGGAGTTTCTACGGAATAATCTCGAGATTATTCCGTAGAAACTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001040111.1-1679s21c1
Sequence:CCGGTGGGCATTGGTATCACCTTTACTCGAGTAAAGGTGATACCAATGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks